Title:
Therapy inhalation involving antisense oligonucleotides for treating idiopathic pulmonary fibrosis
Document Type and Number:
United States Patent 7396823

Abstract:
The invention provides antisense DNA oligonucleotides which are effective in inhibiting the expression of a wild type COL1A1 gene, wherein said oligonucleotides are used in inhalation therapy to treat various lung diseases.

Inventors:
Nath, Rahul K. (3754 Carlon St., Houston, TX, US)
Beri, Rajinder (6 Braefell Close, West Brigford, Nottingham NG2 655, GB)
      Plaque It!

Sponsored by:
Flash of Genius
Application Number:
11/021603
Publication Date:
07/08/2008
Filing Date:
12/21/2004
View Patent Images:
Images are available in PDF form when logged in. To view PDFs, Login  or  Create Account (Free!)
Primary Class:
International Classes:
A61K31/70
Primary Examiner:
Mcgarry, Sean
Assistant Examiner:
Wollenberger, Louis
Attorney, Agent or Firm:
The Matthews Firm
Parent Case Data:

RELATED APPLICATION

This application is a continuation-in-part of U.S. patent application Ser. No. 10/149,352, filed on Jun. 10, 2002 now U.S. Pat. No. 7,173,122, for Antisense Oligonucleotide, and claims priority from PCT/GB00/04741, filed Dec. 12, 2000, and from British Application No. 9929487.8, filed Dec. 15, 1999.

The sequence information required by MPEP 2422.05 is identical to the sequence information provided in U.S. patent application Ser. No. 10/149,352, filed on Jun. 10, 2002 identified above.

Claims:
The invention claimed is:

1. A method of treating a collagen disorder in a patient suffering from, a lung disease relating to the collagen disorder, which comprises administering inhalation therapy to the patient using a therapeutically effective amount of an antisense DNA oligonucleotide having SEQ ID NO:14.

2. The method according to claim 1, wherein said oligonucleotide is administered in association with a pharmaceutically acceptable adjuvant, diluent, or carrier.

Description:

The present invention relates to antisense oligonucleotides and their use in inhibiting expression of type I procollagen.

The collagens are a family of closely related proteins, with a triple helix protein structure. Numerous collagen types have been identified (>10) of which type I procollagen (consisting of two alpha1 chains and one alpha2 chain) is the principal component of bone, skin, and tendon. It has been recognized for many years that many pathological conditions are caused by overproduction of collagen fibers in the form of scars and excess fibrous tissues. For example, liver cirrhosis is a two-step process in which normal liver tissue is first destroyed by a virus or by alcohol and other toxins, and then excessive amounts of collagen fibers replace the damaged cells before normal liver cell regeneration. Idiopathic pulmonary fibrosis (“IPF”) is a lethal condition in which normal lung tissue is gradually replaced by excessive amounts of collagen fibers. Progressive systemic sclerosis (Scleroderma) is a frequently lethal disease where skin and many internal organs become leather-like because of excessive depositions of collagen fibers. In many individuals, wounds or surgical incisions in the skin are followed by excessive depositions of collagen in the form of hypertrophic scars and keloids that present cosmetic problems and sometimes more serious consequences. Also, excessive scarring frequently occurs in normal individuals following trauma and surgical procedures. In these and related conditions, a means of specifically inhibiting collagen synthesis and deposition would be tremendous benefit. PCT Patent Application Publication No. WO 94/11494 discloses a DNA or RNA oligonucleotide comprising from 5 to 200 nucleotides substantially complementary to a mutant collagen nucleotide sequence or normal wild type collagen nucleotide sequence which is capable of inhibiting collagen gene expression. Preferred oligonucleotides are said to be antisense oligonucleotides. The Examples of WO 94/11494 describe a series of DNA oligonucleotides, some of which are antisense, that were synthesized primarily with regard to the region at the 3′ end of exon 1 (from nucleotides 198 to 222) and the first two nucleotides of intron 1 of the gene for the proα1 chains of type I procollagen (COL1A1). The synthesized oligonucleotides were found to vary considerably in their ability of inhibit expression of an internally deleted mutant COL1A1 gene of human origin. The effectiveness of the oligonucleotides in inhibiting the expression of the human wild type COL1A1 gene was not however demonstrated. Since the structure and conformation of the RNA, transcripts of the human, mutant and wild type COL1A1 genes would most likely differ, it would not necessarily follow that oligonucleotides which are effective inhibitors of the expression of the mutant COL1A1 gene would also be effective inhibitors of the expression of the wild type COL1A1 gene.

It would be desirable to identify antisense DNA oligonucleotides that are capable of inhibiting the expression of a wild type COL1A1 gene.

In accordance with the present invention, there is therefore provided an antisense DNA oligonucleotide compromising from 18 to 25 nucleotides which is complementary to a nucleotide sequence from position 750 to position 3000 inclusive of SEQ ID NO:1, wherein SEQ ID NO:1 comprises a nucleotide sequence encoding a polypeptide comprising an amino acid sequence according to SEQ ID No:2, the oligonucleotide being capable of inhibiting expression of the polypeptide in a cell that expresses it.

SEQ ID NO:1 is identical to the nucleotide sequence registered under EMBL accession no Z74615. SEQ ID NO:2 is the amino acid sequence of the polypeptide encoded by the nucleotide sequence of SEQ ID NO:1. The polypeptide encoded by SEQ ID NO:1 is a precursor of the wild type, proα1 chain of type I procollagen (“prepro-alpha1 (I) collagen”).

The antisense DNA oligonucleotide according to the invention comprises 18, 19, 20, 21, 22, 23, 24 or 25 nucleotides and is preferably 20 nucleotides in length.

The antisense DNA oligonucleotide is preferably complementary to a nucleotide sequence in one of the following regions of SEQ ID NO:1,

Region 1 from position 750 to position 900 inclusive,
Region 2 from position 1200 to position 1300 inclusive,
Region 3 from position 1400 to position 1500 inclusive,
Region 4 from position 1450 to position 1550 inclusive,
Region 5 from position 1850 to position 2000 inclusive,
Region 6 from position 2500 to position 2600 inclusive,
Region 7 from position 2850 to position 2950 inclusive,
Region 8 from position 2800 to position 3900 inclusive.

Particularly preferred antisense DNA oligonucleotides are those which are complementary to a nucleotide sequence in Region 2, 4, 6 or 8 of SEQ ID NO:1

The oligonucleotides of the invention may be prepared by any suitable method known in the art. The oligonucleotides are very conveniently prepared by synthetic chemical methods, for example, phosphoramidite chemistry by sulfurization with tetraethylthiuram disulfide in acetonitrile as described in Tetrahedron Lett., 1991, 32, 30005-30008.

The oligonucleotides of the present invention are advantageous in that they inhibit expression of the wild type COL1A1 gene. They are therefore useful in the treatment or prevention of conditions/disorders caused by overproduction of collagen fibers, for example, liver cirrhosis, kidney, liver and heart fibrosis, scleroderma, hypertrophic scars and keloids. Accordingly, the present invention provides an antisense DNA oligonucleotide according to the invention for the use in therapy.

In another aspect, the invention provides the use of an antisense DNA oligonucleotide according to the invention in the manufacture of a medicament for use in therapy.

In the context of the present specification, the term “therapy” also includes “prophylaxis” unless there are specific indications to the contrary. The terms “therapeutic” and “therapeutically” should be construed accordingly.

The invention further provides a method of treating, or reducing the risk of, a collagen disorder in a patient suffering from, or at risk of, the disorder, which comprises administering to the patient a therapeutically effective amount of an antisense DNA oligonucleotide according to the invention.

For the above-mentioned therapeutic uses the dosage administered will, of course, vary with the oligonucleotide employed, the mode of administration, the treatment desired and the disorder indicated. Effective dosages are those which are able to inhibit collagen protein production in cells at a level which eliminates or reduces the symptoms or conditions associated with the collagen protein production.

The oligonucleotides according to the invention will generally be administered in the form of a pharmaceutical composition in which the oligonucleotide is formulated with a pharmaceutically acceptable adjuvant, diluent or carrier.

Thus, the present invention also provides a pharmaceutical composition comprising an antisense DNA oligonucleotide according to the invention in association with a pharmaceutically acceptable adjuvant, diluent or carrier.

The invention further provides a process for the preparation of a pharmaceutical composition of the invention which comprises mixing the antisense DNA oligonucleotide with a pharmaceutically acceptable adjuvant, diluent or carrier.

The pharmaceutical compositor of the invention maybe administered topically in the form of, for example, a creme, lotion or ointment, or systemically, e.g. by oral administration in the form of tablets, capsules, syrups, powders or granules, or by parenteral administration in the form of sterile solutions or suspensions.

The invention also contemplates inhalation therapy for human patients having Idiopathic Pulmonary Fibrosis using a therapeutically effective dosage of the antisense DNA oligonucleotides, in a pharmaceutically acceptable adjuvant, diluent or carrier. Such adjuvants, diluents, and carriers are well known for use in inhalation therapy, and include various gases, vapors, powders, aerosols, and liquids. As but two examples, the antisense DNA oligonucleotides can be delivered to the patient's lungs through the use of various inhalers, which deliver the pharmaceutic composition according to the invention as an aerosol spray, and in addition, a nebulizer that delivers the pharmaceutical composition as a fine mist through a face mask.

In administering inhalation therapy according to the present invention to a patient having idiopathic pulmonary fibrosis, the therapeutically effective dosage will vary considerably based upon several factors. Since the disease is universally lethal, unless reversed, and based upon the underlying cause of the scarring and thickening of the lung tissue, and because the duration of the disease varies in the particular patient, as well as the age and general health of the patient, and the volume of the lung or lungs involved, the dosage will vary, along with the timing of repeat dosages, depending upon the response of the patient to the treatment.

Although by definition, a disease characterized as being idiopathic means that the cause of the disease is unknown, a biopsy of the fibrous lung tissue can sometimes determine the cause of the disease and the dosage for the inhalation therapy can be adjusted accordingly.

The present invention will now be further explained by reference to the following illustrative Examples.

EXAMPLES

Example 1

Oligonucleotide Synthesis

Phosphorothioate oligodeoxynucleotides synthesis was carried out in a 1 μm scale on PE Biosystems 394 DNA synthesizer using phosphoramidite chemistry with TETD/acetonitrile sulphurizing reagent. Oligonucleotides were purified on Poly-Pak TM II cartridges (Glen Research), desalted on NAPTM 10 columns (American Pharmacia Biotech AB) and ion-exchanged using Dowex 50WX8-100 ion exchange resin (Aldrich). Twelve antisense DNA oligonucleotides (ASOs) were prepared having the following sequences (5 ′→3′):

1. GGACGACCAGGTTTTCCAGC (SEQ ID NO:3)
2. GCAGCACCAGCAGGGCCAGG (SEQ ID NO:4)
3. GCCAGGAGCACCAGGTTCAC (SEQ ID NO:5)
4. CTTCCTCTCCAGCAGGGCCA (SEQ ID NO:6)
5. GCCTTGCCGGGCTCTCCAGC (SEQ ID NO:7)
6. CGGGAACACCTCGCTCTCCA (SEQ ID NO:8)
7. GCAGGACCGACAGCGCCAGG (SEQ ID NO:9)
8. TCCATCTTTGCCAGCAGGAC (SEQ ID NO:10)
9. CGTCCCTGAGCTCCAGCCTC (SEQ ID NO:11)
10. TTGGCCGTCAGCACCAGGG (SEQ ID NO:12)
11. TTTCTCGCCAGCAGGGCCAG (SEQ ID NO:13)
12. CTCGATCTGCTGGCTCAGGC (SEQ ID NO:14)

Example 2

Treatment of Cells

The human cell line WI-26 was grown in Dulbecco's modified Eagle's medium (DMEM) containing 10% fetal calf serum. The cells were plated in 48-well plates (Costar, Corning Inc.) to obtain 70-80% confluence. After 24 hours, the cells were washed two times with pre-warmed DMEM and 0.35 ml (for 48-well experiments) or 1 ml (6-well experiments) DMEM containing 5 μg/ml lipofection (Gibco BRL) or 2.5 μg/ml cytofectin GSV (Glen Research Ltd) and oligonucleotides at 200 nM were added to each well. After 4-5 hours at 37° C. the cells were washed two times with pre-warmed DMEM and 0.35 ml DMEM (48-well plates) or 1 ml DMEM (6 well plates) was added together with ascorbic acid at 10 μg/ml. The cells were incubated for 20 hours prior to analysis of collagen levels.

Example 3

Protein Analysis

At the end of the experiment, 150 μl of medium was removed and the amount of secreted type I procollagen determined using an ELISA kit (AmershamPharmacia Ltd) and the results expressed as nanograms of procollagen in the medium/10,000 cells. To correct for cell numbers, plates were washed with pre-warmed PBS, cells treated with trypsin and cell numbers determined using a automated Coulter counter. For 6-well experiments, the cells were counted, treated with 1 ml TRI reagent (SIGMA Ltd) and proteins and RNA extracted according to the manufacturers guidelines. The protein pellet was re-suspended in 1% SDS containing protease inhibitors. 30-100 μgs cellular proteins were heated at 100° C. for 5 minutes and then lectrophoresed in a 4-12% SDS polyacrylamide gel. Proteins were electrophoretically transferred to nitrocellulose filters and hybridized with an antibody against a synthetic peptide corresponding to human proα(I) chain of type 1 collagen (obtained from Dr. Larry Fisher, NIH, USA). The proα1(1) band was detected using ECL (Pierce Ltd). Protein loading was determined by treating the membrane with an antibody to GAPDH (Advanced Immunochemicals). Protein loading was normalized to GAPDH levels using desitometry.

Example 4

RNA Analysis

RNA was extracted using TRI reagent and the final pellet was re-suspended in 0.5% SDS. One to three micrograms of total RNA were electrophoresed in a formaldehyde denaturing gel according to standard procedures (Sambrook, J., Fritsch, E. F. and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual, 2 nd Ed., Cold Spring Harbor Laboratory Press, (Amersham) and hybridized for 24 hours to an alpha1 (1) cDNA probe radiolabeled using a T7 polymerase kit (AmershamPharmacia). Following washing, the filter was exposed to X-ray film and the film developed 4-24 hours later. The autoradiographic images of the alpha1(1) transcripts (4.8 kb & 5.8 kb) were analyzed by densitometric analysis and RNA loading was corrected using the intensity of the GAPDH transcript or the intensity of the 28S rRNA as internal controls.

Results

Table I below shows the average percentage (%) collagen inhibition which related to either collagen levels in the medium or collagen mRNA levels. In the treated cell assay used, there was a very good correlation between percentage collagen inhibitation as measured in the medium and percentage inhibition of intracellular collagen mRNA levels.

TABLE I
AVERAGE %
COLLAGEN
ASO INHIBITION
CGACGACCAGGTTTTCCAGC (SEQ ID NO:3) 50
GCAGCACCAGCACCAGGTTCAC (SEQ ID NO:4) 50-80
GCCAGGAGCACCAGGTTCAC (SEQ ID NO:5) 50
CTTCCTCTCCAGCAGGGCCA (SEQ ID NO:6) 50-60
GCCTTGCGGGCTCC TCCAGC (SEQ ID NO:7) 50
CGGGAACACCTCGCTCTCCA (SEQ ID NO:8) 50
GCAGGACCGACAGCGCCAGG (SEQ ID NO:9) 50
TCCATCTTTGCCAGCAGGAC (SEQ ID NO:10) 50
GGTCCCTGAGCTCCAGCCTC (SEQ ID NO:11) 50
TTGGCCGTCAGCACCAGGG (SEQ ID NO:12) 50-80
TTTCTCGCCAGCAGGGCCAG (SEQ ID NO:13) 50-70
CTCGATCTGCTGGCTCAGGC (SEQ ID NO:14) 50-80





<- Previous Patent (Immunogenic minicell...)   |   Next Patent (2-O sulfatase nuclei...) ->