Title:

High affinity nucleic acid ligands to lectins

Document Type and Number:

United States Patent 7399752

Abstract:

This invention discloses high-affinity oligonucleotide ligands to lectins, specifically nucleic acid ligands having the ability to bind to the lectins, wheat germ agglutinin, L-selectin, E-selectin and P-selectin. Also disclosed are the methods for obtaining such ligands.

Inventors:

Parma, David H. (Boulder, CO, US)
Hicke, Brian (Boulder, CO, US)
Bridonneau, Philippe (Boulder, CO, US)
Gold, Larry (Boulder, CO, US)

Plaque It!

RELATEDNESS OF THE APPLICATION

This application is a continuation of U.S. Ser. No. 09/849,928, filed May 4, 2001, which is a divisional of U.S. Ser. No. 08/952,793, filed Nov. 21, 1997, now U.S. Pat. No. 6,280,932, which is a 35 U.S.C. § 371 national phase of PCT/US96/09455, filed Jun. 5, 1996, which is a continuation-in-part of each of the following: U.S. Ser. No. 08/479,724, filed Jun. 7, 1995, now U.S. Pat. No. 5,780,228; U.S. Ser. No. 08/472,256, filed Jun. 7, 1995, now U.S. Pat. No. 6,001,988; U.S. Ser. No. 08/472,255, filed Jun. 7, 1995, now U.S. Pat. No. 5,766,853; and U.S. Ser. No. 08/477,829, filed Jun. 7, 1995, now abandoned. Each of the foregoing applications filed on Jun. 7, 1995, is a continuation-in-part of U.S. Ser. No. 07/714,131, filed Jun. 10, 1991, now U.S. Pat. No. 5,475,096, which is a continuation-in-part of U.S. Ser. No. 07/536,428, filed Jun. 11, 1990, now abandoned.

Claims:

We claim:

1. A method of inhibiting binding between L-selectin and a carbohydrate ligand of said L-selectin, comprising the step of contacting a nucleic acid ligand to said L-selectin with said L-selectin wherein said nucleic acid ligand to L-selectin is selected from the group consisting of SEQ ID NO: 67-117, 129-196, and 293-388.

2. A method of inhibiting binding between P-selectin and a carbohydrate ligand of said P-selectin, comprising the step of contacting a nucleic acid ligand to said P-selectin with said P-selectin wherein said nucleic acid ligand to P-selectin is selected from the group consisting of SEQ ID NO: 199-247, and 251-290.

3. A method of modulating leukocyte adhesion or migration, comprising inhibiting binding between a P- or L-selectin on a first cell and a ligand to said selectin on a second cell, said inhibiting comprising the step of permitting a nucleic acid ligand to the selectin to interact with the first cell, wherein the first cell is a leukocyte selected from the group consisting of neutrophils and monocytes, the second cell is a vascular endothelial cell and wherein said nucleic acid ligand is selected from the group consisting of SEQ ID NO: 67-117, 129-196, 199-247, 251-290 and 293-388.

4. A method for modulating platelet adhesion, comprising inhibiting binding between a P-selectin on a first cell and a ligand to said P-selectin on a second cell, said inhibiting comprising the step of permitting a nucleic acid ligand to said P-selectin to interact with the first cell, wherein the first cell is a platelet, wherein said nucleic acid ligand to said P-selectin is selected from the group consisting of SEQ ID NO:199-247 and 251-290.

5. A method of modulating leukocyte adhesion or migration, comprising inhibiting binding between an L-selectin on a first cell and a ligand to said L-selectin on a second cell, said inhibiting comprising the step of permitting a nucleic acid ligand to said L-selectin to interact with the first cell, wherein the first cell is a leukocyte selected from the group consisting of lymphocytes, granulocytes, neutrophils and monocytes, the second cell is a vascular endothelial cell or a lymphatic cell and wherein said nucleic acid ligand to said L-selectin is selected from the group consisting of SEQ ID NO: 67-117, 129-196 and 293-388.

6. A method of modulating lymphocyte adhesion, migration or activation comprising inhibiting binding between an L-selectin on a first cell and a ligand to said L-selectin on a second cell, said inhibiting comprising the step of permitting a nucleic acid ligand to said L-selectin to interact with the first cell, wherein the first cell is a lymphocyte, the second cell is a vascular endothelial cell and wherein said nucleic acid ligand is selected from the group consisting of SEQ ID NO: 67-117, 129-196 and 293-388.

7. A method of inhibiting binding between P-selectin and a carbohydrate ligand of said P-selectin, comprising the step of contacting a nucleic acid ligand to said P-selectin with said P-selectin wherein said nucleic acid ligand to P-selectin comprises SEQ ID NO: 223.

8. The method of claim 7 wherein SEQ ID NO: 223 further comprises at least one 2′-O-methyl purine.

9. The method of claim 7 wherein SEQ ID NO: 223 further comprises 2′-OMe purines at positions 7, 8, 9, 15, 27, 28 and 31.

10. The method of claim 9 wherein SEQ ID NO: 223 further comprises a 2′-OMe purine at one or more of the following positions 13, 14, 16, 18, 21, 22, 24 and 30.

11. The method of claim 9 wherein SEQ ID NO: 223 further comprises 2′-OMe purines at positions 13, 14, 18, 21, 22, and 24.

12. A method of modulating leukocyte adhesion or migration, comprising inhibiting binding between a P-selectin on a first cell and a ligand to said P-selectin on a second cell, said inhibiting comprising the step of permitting a nucleic acid ligand to the selectin to interact with the first cell, wherein the first cell is a leukocyte selected from the group consisting of neutrophils and monocytes, the second cell is a vascular endothelial cell and wherein said nucleic acid ligand comprises SEQ ID NO: 223.

13. The method of claim 12 wherein SEQ ID NO: 223 further comprises at least one 2′-O-methyl purine.

14. The method of claim 12 wherein SEQ ID NO: 223 further comprises 2′-OMe purines at positions 7, 8, 9, 15, 27, 28 and 31.

15. The method of claim 14 wherein SEQ ID NO: 223 further comprises a 2′-OMe purine at one or more of the following positions 13, 14, 16, 18, 21, 22, 24 and 30.

16. The method of claim 14 wherein SEQ ID NO: 223 further comprises 2′-OMe purines at positions 13, 14, 18, 21, 22, and 24.

17. A method for modulating platelet adhesion, comprising inhibiting binding between a P-selectin on a first cell and a ligand to said P-selectin on a second cell, said inhibiting comprising the step of permitting a nucleic acid ligand to said P-selectin to interact with the first cell, wherein the first cell is a platelet, wherein said nucleic acid ligand to said P-selectin comprises SEQ ID NO: 223.

18. The method of claim 17 wherein SEQ ID NO: 223 further comprises at least one 2′-O-methyl purine.

19. The method of claim 17 wherein SEQ ID NO: 223 further comprises 2′-OMe purines at positions 7, 8, 9, 15, 27, 28 and 31.

20. The method of claim 19 wherein SEQ ID NO: 223 further comprises a 2′-OMe purine at one or more of the following positions 13, 14, 16, 18, 21, 22, 24 and 30.

21. The method of claim 19 wherein SEQ ID NO: 223 further comprises 2′-OMe purines at positions 13, 14, 18, 21, 22, and 24.

Description:

FIELD OF THE INVENTION

Described herein are methods for identifying and preparing high-affinity nucleic acid ligands to lectins. Lectins are carbohydrate binding proteins. The method utilized herein for identifying such nucleic acid ligands is called SELEX, an acronym for Systematic Evolution of Ligands by EXponential enrichment. Specifically disclosed herein are high-affinity nucleic acid ligands to wheat germ agglutinin (WGA), L-selectin, E-selectin, and P-selectin.

BACKGROUND OF THE INVENTION

The biological role of lectins (non-enzymatic carbohydrate-binding proteins of non-immune origin; I. J. Goldstein et al., 1980, Nature 285:66) is inextricably linked to that of carbohydrates. One function of carbohydrates is the modification of physical characteristics of glyco-conjugates (i.e., solubility, stability, activity, susceptibility to enzyme or antibody recognition), however, a more interesting and relevant aspect of carbohydrate biology has emerged in recent years; the carbohydrate portions of glyco-conjugates are information rich molecules (N. Sharon and H. Lis, 1989, Science 246:227-234; K. Drickamer and M. Taylor, 1993, Annu. Rev. Cell Biol. 9:237-264; A. Varki, 1993, Glycobiol. 3:97-130). Within limits, the binding of carbohydrates by lectins is specific (i.e., there are lectins that bind only galactose or N-acetylgalactose; other lectins bind mannose; still others bind sialic acid and so on; K. Drickamer and M. Taylor, supra). Specificity of binding enables lectins to decode information contained in the carbohydrate portion of glyco-conjugates and thereby mediate many important biological functions.

Numerous mammalian, plant, microbial and viral lectins have been described (I. Ofek and N. Sharon, 1990, Current Topics in Microbiol. and Immunol. 151:91113; K. Drickamer and M. Taylor, supra; I. J. Goldstein and R. D. Poretz, 1986, in The Lectins, p.p. 33-247; A. Varki, supra). These proteins mediate a diverse array of biological processes which include: trafficking of lysosomal enzymes, clearance of serum proteins, endocytosis, phagocytosis, opsonization, microbial and viral infections, toxin binding, fertilization, immune and inflammatory responses, cell adhesion and migration in development and in pathological conditions such as metastasis. Roles in symbiosis and host defense have been proposed for plant lectins but remain controversial. While the functional role of some lectins is well understood, that of many others is understood poorly or not at all.

The diversity and importance of processes mediated by lectins is illustrated by two well documented mammalian lectins, the asialoglycoprotein receptor and the serum mannose binding protein, and by the viral lectin, influenza virus hemagglutinin. The hepatic asialoglycoprotein receptor specifically binds galactose and N-acetylgalactose and thereby mediates the clearance of serum glycoproteins that present terminal N-acetylgalactose or galactose residues, exposed by the prior removal of a terminal sialic acid. The human mannose-binding protein (MBP) is a serum protein that binds terminal mannose, fucose and N-acetylglucosamine residues. These terminal residues are common on microbes but not mammalian glyco-conjugates. The binding specificity of MBP constitutes a non-immune mechanism for distinguishing self from non-self and mediates host defense through opsonization and complement fixation. Influenza virus hemagglutinin mediates the initial step of infection, attachment to nasal epithelial cells, by binding sialic acid residues of cell-surface receptors.

The diversity of lectin mediated functions provides a vast array of potential therapeutic targets for lectin antagonists. Both lectins that bind endogenous carbohydrates and those that bind exogenous carbohydrates are target candidates. For example, antagonists to the mammalian selecting, a family of endogenous carbohydrate binding lectins, may have therapeutic applications in a variety of leukocyte-mediated disease states Inhibition of selectin binding to its receptor blocks cellular adhesion and consequently may be useful in treating inflammation, coagulation, transplant rejection, tumor metastasis, rheumatoid arthritis, reperfusion injury, stroke, myocardial infarction, burns, psoriasis, multiple sclerosis, bacterial sepsis, hypovolaemic and traumatic shock, acute lung injury, and ARDS.

The selecting, E-, P- and L-, are three homologous C-type lectins that recognize the tetrasaccharide, sialyl-Lewis ^x(C. Foxall et al, 1992, J. Cell Biol. 117,895-902). Selectins mediate the initial adhesion of neutrophils and monocytes to activated vascular endothelium at sites of inflammation (R. S. Cotran et al., 1986, J. Exp. Med. 164, 661-; M. A. Jutila et al., 1989, J. Immunol. 143,3318-; J. G. Geng et al., 1990, Nature, 757; U. H. Von Adrian et al., 1994, Am. J. Physiol. Heart Circ. Physiol. 263, H1034-H1044). In addition, L-selectin is responsible for the homing of lymphocytes to peripheral and mesenteric lymph nodes (W. M. Gallatin et al., 1983, Nature 304,30; T. K. Kishimoto et al., 1990, Proc. Natl. Acad. Sci. 87,2244-) and P-selectin mediates the adherence of platelets to neutrophils and monocytes (S-C. Hsu-Lin et al., 1984, J. Biol. Chem. 259,9121).

Selectin antagonists (antibodies and carbohydrates) have been shown to block the extravasation of neutrophils at sites of inflammation (P. Piscueta and F. W. Luscinskas, 1994, Am. J. Pathol. 145, 461-469), to be efficacious in animal models of ischemia/reperfusion (A. S. Weyrich et al., 1993, J. Clin. Invest. 91,2620-2629; R. K. Winn et al., 1993, J. Clin. Invest. 92, 2042-2047), acute lung injury (M. S. Mulligan et al., 1993, J. Immunol. 151, 6410-6417; A. Seekamp et al., 1994, Am. J. Pathol. 144, 592-598), insulitis/diabetes (X. D. Yang et al., 1993, Proc. Natl. Acad. Sci. 90,10494-10498), meningitis (C. Granet et al., 1994, J. Clin. Invest. 93, 929-936), hemorrhagic shock (R. K. Winn et al., 1994, Am J. Physiol. Heart Circ. Physiol. 267, H2391-H2397) and transplantation. In addition, selectin expression has been documented in models of arthritis (F. Jamar et al., 1995, Radiology 194, 843-850), experimental allergic encephalomyelitis (J. M. Dopp et al., 1994, J. Neuroimmunol. 54, 129-144), cutaneous inflammation (A. Siber et al., 1994, Lab. Invest. 70, 163-170) glomerulonephritis (P. G. Tipping et al., 1994, Kidney Int. 46, 79-88), on leukaemic cells and colon carcinomas (R. M. Lafrenie et al., 1994, Eur. J. Cancer [A] 30A, 2151-2158) and L-selectin receptors have been observed in myelinated regions of the central nervous system (K. Huang et al., 1991, J. Clin. Invest. 88, 1778-1783). These animal model data strongly support the expectation of a therapeutic role for selectin antagonists in a wide variety of disease states in which host tissue damage is neutrophil-mediated.

Other examples of lectins that recognize endogenous carbohydrates are CD22β, CD23, CD44 and sperm lectins (A. Varki, 1993, Glycobiol.3, 97-130; P. M. Wassarman, 1988, Ann. Rev. Biochem. 57, 415442). CD22β is involved in early stages of B lymphocyte activation; antagonists may modulate the immune response. CD23 is the low affinity IgE receptor; antagonists may modulate the IgE response in allergies and asthma. CD44 binds hyaluronic acid and thereby mediates cell/cell and cell/matrix adhesion; antagonists may modulate the inflammatory response. Sperm lectins are thought to be involved in sperm/egg adhesion and in the acrosomal response; antagonists may be effective contraceptives, either by blocking adhesion or by inducing a premature, spermicidal acrosomal response.

Antagonists to lectins that recognize exogenous carbohydrates may have wide application for the prevention of infectious diseases. Many viruses (influenza A, B and C; Sendhi, Newcastle disease, coronavirus, rotavirus, encephalomyelitis virus, enchephalomyocarditis virus, reovirus, paramyxovirus) use lectins on the surface of the viral particle for attachment to cells, a prerequisite for infection; antagonists to these lectins are expected to prevent infection (A. Varki, 1993, Glycobiol.3, 97-130). Similarly colonization/infection strategies of many bacteria utilize cell surface lectins to adhere to mammalian cell surface glyco-conjugates. Antagonists to bacterial cell surface lectins are expected to have therapeutic potential for a wide spectrum of bacterial infections, including: gastric ( Helicobacter pylori ), urinary tract ( E. coli ), pulmonary ( Klebsiella pneumoniae, Stretococcus pneumoniae, Mycoplasma pneumoniae ) and oral ( Actinomyces naeslundi and Actinomyces viscosus ) colonization/infection (S. N. Abraham, 1994, Bacterial Adhesins, in The Handbook of Immunuopharmacology: Adhesion Molecules, C. D. Wegner, ed; B. J. Mann et al., 1991, Proc. Natl. Acad. Sci. 88, 3248-3252). A specific bacterial mediated disease state is Pseudomonas aeruginosa infection, the leading cause of morbidity and mortality in cystic fibrosis patients. The expectation that high affinity antagonists will have efficacy in treating P. aeruginosa infection is based on three observations. First, a bacterial cell surface, GalNAcβ1-4Gal binding lectin mediates infection by adherence to asialogangliosides (αGM1 and αGM2) of pulmonary epithelium (L. Imundo et al., 1995, Proc. Natl. Acad. Sci 92, 3019-3023). Second, in vitro, the binding of P. aeruginosa is competed by the gangliosides' tetrasaccharide moiety, Galβ1-3GalNAcβ1-4Galβ1-4Glc. Third, in vivo, instillation of antibodies to Pseudomonas surface antigens can prevent lung and pleural damage (J. F. Pittet et al., 1993, J. Clin. Invest. 92, 1221-1228).

Non-bacterial microbes that utilize lectins to initiate infection include Entamoeba histalytica (a Gal specific lectin that mediates adhesion to intestinal mucosa; W. A. Petri, Jr., 1991, AMS News 57:299-306) and Plasmodium faciparum (a lectin specific for the terminal Neu5Ac(a2-3)Gal of glycophorin A of erthrocytes; P. A. Orlandi et al., 1992, J. Cell Biol. 116:901-909). Antagonists to these lectins are potential therapeutics for dysentery and malaria.

Toxins are another class of proteins that recognize exogenous carbohydrates (K-A Karlsson, 1989, Ann. Rev. Biochem. 58:309-350). Toxins are complex, two domain molecules, composed of a functional and a cell recognition/adhesion domain. The adhesion domain is often a lectin (i.e., bacterial toxins: pertussis toxin, cholera toxin, heat labile toxin, verotoxin and tetanus toxin; plant toxins: ricin and abrin). Lectin antagonists are expected to prevent these toxins from binding their target cells and consequently to be useful as antitoxins.

There are still other conditions for which the role of lectins is currently speculative. For example, genetic mutations result in reduced levels of the serum mannose-binding protein (MBP). Infants who have insufficient levels of this lectin suffer from severe infections, but adults do not. The high frequency of mutations in both oriental and Caucasian populations suggests a condition may exist in which low levels of serum mannose-binding protein are advantageous. Rheumatoid arthritis (RA) may be such a condition. The severity of RA is correlated with an increase in IgG antibodies lacking terminal galactose residues on Fc region carbohydrates (A. Young et al., 1991, Arth. Rheum. 34, 1425-1429; I. M. Roitt et al., 1988, J. Autoimm. 1, 499-506). Unlike their normal counterpart, these gal-deficient carbohydrates are substrates for MBP. MBP/IgG immunocomplexes may contribute to host tissue damage through complement activation. Similarly, the eosinophil basic protein is cytotoxic. If the cytotoxicity is mediated by the lectin activity of this protein, then a lectin antagonist may have therapeutic applications in treating eosinophil mediated lung damage.

Lectin antagonists may also be useful as imaging agents or diagnostics. For example, E-selectin antagonists may be used to image inflamed endothelium. Similarly antagonists to specific serum lectins, i.e. mannose-binding protein, may also be useful in quantitating protein levels.

Lectins are often complex, multi-domain, multimeric proteins. However, the carbohydrate-binding activity of mammalian lectins is normally the property of a carbohydrate recognition domain or CRD. The CRDs of mammalian lectins fall into three phylogenetically conserved classes: C-type, S-type and P-type (K. Drickamer and M. E. Taylor, 1993, Annu. Rev. Cell Biol. 9, 237-264). C-type lectins require Ca ⁺⁺ for ligand binding, are extracellular membrane and soluble proteins and, as a class, bind a variety of carbohydrates. S-type lectins are most active under reducing conditions, occur both intra- and extracellularly, bind β-galactosides and do not require Ca ⁺⁺. P-type lectins bind mannose 6-phosphate as their primary ligand.

Although lectin specificity is usually expressed in terms of monosaccharides and/or oligosacchrides (i.e., MBP binds mannose, fucose and N-acetylglucosamine), the affinity for monosaccharides is weak. The dissociation constants for monomeric saccharides are typically in the millimolar range (Y. C. Lee, 1992, FASEB J. 6:3193-3200; G. D. Glick et al., 1991, J Biol. Chem. 266:23660-23669; Y. Nagata and M. M. Burger, 1974, J. Biol. Chem. 249:116-3122).

Co-crystals of MBP complexed with mannose oligomers offer insight into the molecular limitations on affinity and specificity of C-type lectins (W. I. Weis et al., 1992, Nature 360:127-134; K. Drickamer, 1993, Biochem. Soc. Trans. 21:456-459). The 3- and 4-hydroxyl groups of mannose form coordination bonds with bound Ca ⁺⁺ ion #2 and hydrogen bonds with glutamic acid (185 and 193) and asparagine (187 and 206). The limited contacts between the CRD and bound sugar are consistent with its spectrum of monosaccharide binding; N-acetylglucosamine has equatorial 3- and 4-hydroxyls while fucose has similarly configured hydroxyls at the 2 and 3 positions.

The affinity of the mannose-binding protein and other lectins for their natural ligands is greater than that for monosaccharides. Increased specificity and affinity can be accomplished by establishing additional contacts between a protein and its ligand (K. Drickamer, 1993, supra) either by 1) additional contacts with the terminal sugar (i.e., chicken hepatic lectin binds N-acetylglucose amine with greater affinity than mannose or fucose suggesting interaction with the 2-substituent); 2) clustering of CRDs for binding complex oligosaccharides (i.e., the mammalian asialylglycoprotein receptor); 3) interactions with additional saccharide residues (i.e., the lectin domain of selectins appears to interact with two residues of the tetrasaccharide sialyl-Lewis ^x: with the charged terminal residue, sialic acid, and with the fucose residue; wheat germ agglutinin appears to interact with all three residues of trimers of N-acetylglucosamine); or by 4) contacts with a non-carbohydrate portion of a glyco-protein.

The low affinity of lectins for mono- and oligo-saccharides presents major difficulties in developing high affinity antagonists that may be useful therapeutics. Approaches that have been used to develop antagonists are similar to those that occur in nature: 1) addition or modification of substituents to increase the number of interactions; and 2) multimerization of simple ligands.

The first approach has had limited success. For example, homologues of sialic acid have been analyzed for affinity to influenza virus hemagglutinin (S. J. Watowich et al. 1994, Structure 2:719-731). The dissociation constants of the best analogues are 30 to 300 μM which is only 10 to 100-fold better than the standard monosaccharide.

Modifications of carbohydrate ligands to the selectins have also had limited success. In static ELISA competition assays, sialyl-Lewis ^aand sialyl-Lewis ^xhave IC ₅₀s of 220 μM and 750 μM, respectively, for the inhibition of the binding of an E-selectin/IgG chimera to immobilized sialyl-Lewis ^x(R. M. Nelson et al., 1993, J. Clin. Invest. 91, 1157-1166). The IC ₅₀of a sialyl-Lewis ^aderivative (addition of an aliphatic aglycone to the GlcNAc and replacement of the N-acetyl with an NH ₂group) improved 10-fold to 21 μM. Similarly, removal of the N-acetyl from sialyl-lewis ^ximproves inhibition in an assay dependent manner (C. Foxall et al., 1992, J. Cell Biol. 117, 895-902; S. A. DeFrees et al., 1993, J. Am. Chem. Soc. 115, 7549-7550).

The second approach, multimerization of simple ligands, can lead to dramatic improvements in affinity for lectins that bind complex carbohydrates (Y. C. Lee, supra). On the other hand, the approach does not show great enhancement for lectins that bind simple oligosaccharides; dimerizing sialyl-Lewis ^x, a minimal carbohydrate ligand for E-selectin, improves inhibition approximately 5-fold (S. A. DeFrees et al., supra).

An alternative approach is to design compounds that are chemically unrelated to the natural ligand. In the static ELISA competition assays inositol polyanions inhibit L- and P-selectin binding with IC ₅₀s that range from 1.4 μM to 2.8 mM (O. Cecconi et al., 1994, J. Biol. Chem. 269, 15060-15066). Synthetic oligopeptides, based on selectin amino acid sequences, inhibit neutrophil binding to immobilized P-selectin with IC ₅₀s ranging from 50 μM to 1 mM (J-G Geng et al., 1992, J of Biol. Chem. 267, 19846-19853).

Lectins are nearly ideal targets for isolation of antagonists by SELEX technology described below. The reason is that oligonucleotide ligands that are bound to the carbohydrate binding site can be specifically eluted with the relevant sugar(s). Oligonucleotide ligands with affinities that are several orders of magnitude greater than that of the competing sugar can be obtained by the appropriate manipulation of the nucleic acid ligand to competitor ratio. Since the carbohydrate binding site is the active site of a lectin, essentially all ligands isolated by this procedure will be antagonists. In addition, these SELEX ligands will exhibit much greater specificity than monomeric and oligomeric saccharides.

A method for the in vitro evolution of nucleic acid molecules with highly specific binding to target molecules has been developed. This method, Systematic Evolution of Ligands by EXponential enrichment, termed SELEX, is described in U.S. patent application Ser. No. 07/536,428, entitled “Systematic Evolution of Ligands by Exponential Enrichment,” now abandoned, U.S. patent application Ser. No. 07/714,131, filed Jun. 10, 1991, entitled “Nucleic Acid Ligands,” now U.S. Pat. No. 5,475,096, U.S. patent application Ser. No. 07/931,473, filed Aug. 17, 1992, entitled “Methods for Identifying Nucleic Acid Ligands,” now U.S. Pat. No. 5,270,163 (see also PCT/US91/04078), each of which is herein specifically incorporated by reference. Each of these applications, collectively referred to herein as the SELEX Patent Applications, describes a fundamentally novel method for making a nucleic acid ligand to any desired target molecule.

The SELEX method involves selection from a mixture of candidate oligonucleotides and step-wise iterations of binding, partitioning and amplification, using the same general selection scheme, to achieve virtually any desired criterion of binding affinity and selectivity. Starting from a mixture of nucleic acids, preferably comprising a segment of randomized sequence, the SELEX method includes steps of contacting the mixture with the target under conditions favorable for binding, partitioning unbound nucleic acids from those nucleic acids which have bound specifically to target molecules, dissociating the nucleic acid-target complexes, amplifying the nucleic acids dissociated from the nucleic acid-target complexes to yield a ligand-enriched mixture of nucleic acids, then reiterating the steps of binding, partitioning, dissociating and amplifying through as many cycles as desired to yield highly specific, high affinity nucleic acid ligands to the target molecule.

The basic SELEX method has been modified to achieve a number of specific objectives. For example, U.S. patent application Ser. No. 07/960,093, filed Oct. 14, 1992, entitled “Method for Selecting Nucleic Acids on the Basis of Structure,” describes the use of SELEX in conjunction with gel electrophoresis to select nucleic acid molecules with specific structural characteristics, such as bent DNA. U.S. patent application Ser. No. 08/123,935, filed Sep. 17, 1993, entitled “Photoselection of Nucleic Acid Ligands” describes a SELEX based method for selecting nucleic acid ligands containing photoreactive groups capable of binding and/or photocrosslinking to and/or photoinactivating a target molecule. U.S. patent application Ser. No. 08/134,028, filed Oct. 7, 1993, entitled “High-Affinity Nucleic Acid Ligands That Discriminate Between Theophylline and Caffeine,” describes a method for identifying highly specific nucleic acid ligands able to discriminate between closely related molecules, termed Counter-SELEX. U.S. patent application Ser. No. 08/143,564, filed Oct. 25, 1993, entitled “Systematic Evolution of Ligands by EXponential Enrichment: Solution SELEX,” describes a SELEX-based method which achieves highly efficient partitioning between oligonucleotides having high and low affinity for a target molecule. U.S. patent application Ser. No. 07/964,624, filed Oct. 21, 1992, entitled “Methods of Producing Nucleic Acid Ligands Ligands to HIV-RT and HIV-1 Rev,” now U.S. Pat. No. 5,496,938 describes methods for obtaining improved nucleic acid ligands after SELEX has been performed. U.S. patent application Ser. No. 08/400,440, filed Mar. 8, 1995, entitled “Systematic Evolution of Ligands by EXponential Enrichment: Chemi-SELEX,” now U.S. Pat. No. 5,705,337 describes methods for covalently linking a ligand to its target.

The SELEX method encompasses the identification of high-affinity nucleic acid ligands containing modified nucleotides conferring improved characteristics on the ligand, such as improved in vivo stability or improved delivery characteristics. Examples of such modifications include chemical substitutions at the ribose and/or phosphate and/or base positions. SELEX-identified nucleic acid ligands containing modified nucleotides are described in U.S. patent application Ser. No. 08/117,991, filed Sep. 8, 1993, entitled “High Affinity Nucleic Acid Ligands Containing Modified Nucleotides,” that describes oligonucleotides containing nucleotide derivatives chemically modified at the 5- and 2′-positions of pyrimidines. U.S. patent application Ser. No. 08/134,028, supra, describes highly specific nucleic acid ligands containing one or more nucleotides modified with 2′-amino (2′-NH ₂), 2′-fluoro (2′-F), and/or 2′-O-methyl (2′-OMe). U.S. patent application Ser. No. 08/264,029, filed Jun. 22, 1994, entitled “Novel Method of Preparation of 2′ Modified Pyrimidine Intramolecular Nucleophilic Displacement,” describes novel methods for making 2′-modified nucleosides.

The SELEX method encompasses combining selected oligonucleotides with other selected oligonucleotides as described in U.S. patent application Ser. No. 08/284,063, filed Aug. 2, 1994, entitled “Systematic Evolution of Ligands by Exponential Enrichment: Chimeric SELEX,” now U.S. Pat. No. 5,637,459. The SELEX method also includes combining the selected nucleic acid ligands with non-oligonucleotide functional units and U.S. patent application Ser. No. 08/234,997, filed Apr. 28, 1994, entitled “Systematic Evolution of Ligands by Exponential Enrichment: Blended SELEX”, now U.S. Pat. No. 5,683,867, and U.S. patent application Ser. No. 08/434,465, filed May 4, 1995, entitled “Nucleic Acid Ligand Complexes”, now U.S. Pat. No. 6,011,020. These applications allow the combination of the broad array of shapes and other properties, and the efficient amplification and replication properties, of oligonucleotides with the desirable properties of other molecules. Each of the above described patent applications which describe modifications of the basic SELEX procedure are specifically incorporated by reference herein in their entirety.

The present invention applies the SELEX methodology to obtain nucleic acid ligands to lectin targets. Lectin targets, or lectins, include all the non-enzymatic carbohydrate-binding proteins of non-immune origin, which include, but are not limited to, those described above.

Specifically, high affinity nucleic acid ligands to wheat germ agglutinin, and various selectin proteins have been isolated. For the purposes of the invention the terms wheat germ agglutinin, wheat germ lectin and WGA are used interchangeably. Wheat germ agglutinin (WGA) is widely used for isolation, purification and structural studies of glyco-conjugates. As outlined above, the selectins are important anti-inflammatory targets. Antagonists to the selectins modulate extravasion of leukocytes at sites of inflammation and thereby reduce neutrophil caused host tissue damage. Using the SELEX technology, high affinity antagonists of L-selectin, E-selectin and P-selectin mediated adhesion are isolated.

BRIEF SUMMARY OF THE INVENTION

The present invention includes methods of identifying and producing nucleic acid ligands to lectins and the nucleic acid ligands so identified and produced. More particularly, nucleic acid ligands are provided that are capable of binding specifically to Wheat Germ Agglutinin (WGA), L-Selectin, E-selectin and P-selectin.

Further included in this invention is a method of identifying nucleic acid ligands and nucleic acid ligand sequences to lectins comprising the steps of (a) preparing a candidate mixture of nucleic acids, (b) partitioning between members of said candidate mixture on the basis of affinity to said lectin, and (c) amplifying the selected molecules to yield a mixture of nucleic acids enriched for nucleic acid sequences with a relatively higher affinity for binding to said lectin.

More specifically, the present invention includes the nucleic acid ligands to lectins identified according to the above-described method, including those ligands to Wheat Germ Agglutinin listed in Table 2, those ligands to L-selectin listed in Tables 8, 12 and 16, and those ligands to P-selectin listed in Tables 19 and 25. Additionally, nucleic acid ligands to E-selectin and serum mannose binding protein are provided. Also included are nucleic acid ligands to lectins that are substantially homologous to any of the given ligands and that have substantially the same ability to bind lectins and antagonize the ability of the lectin to bind carbohydrates. Further included in this invention are nucleic acid ligands to lectins that have substantially the same structural form as the ligands presented herein and that have substantially the same ability to bind lectins and antagonize the ability of the lectin to bind carbohydrates.

The present invention also includes modified nucleotide sequences based on the nucleic acid ligands identified herein and mixtures of the same.

The present invention also includes the use of the nucleic acid ligands in therapeutic, prophylactic and diagnostic applications.

BRIEF DESCRIPTION OF THE FIGURES

FIG. 1 shows consensus hairpin secondary structures for WGA 2′-NH ₂RNA ligands: (a) family 1, (b) family 2 and (c) family 3. Nucleotide sequence is in standard one letter code. Invariant nucleotides are in bold type. Nucleotides derived from fixed sequence are in lower case.

FIG. 2 shows binding curves for the L-selectin SELEX second and ninth round 2′-NH ₂RNA pools to peripheral blood lymphocytes (PBMCs).

FIG. 3 shows binding curves for random 40N7 2′-NH ₂RNA (SEQ ID NO: 64) and the cloned L-selectin ligand, F14.12 (SEQ ID NO: 78), to peripheral blood lymphocytes (PBMC).

FIG. 4 shows the results of a competition experiment in which the binding of 5 nM ³²P-labeled F14.12 (SEQ ID NO: 78) to PBMCs (10 ⁷/ml) is competed with increasing concentrations of unlabeled F14.12 (SEQ ID NO: 78). RNA Bound equals 100×(net counts bound in the presence of competitor/net counts bound in the absence of competitor).

FIG. 5 shows the results of a competition experiment in which the binding of 5 nM ³²P-labeled F14.12 (SEQ ID NO: 78) to PBMCs (10 ⁷/ml) is competed with increasing concentrations of the blocking monoclonal anti-L-selectin antibody, DREG-56, or an isotype matched, negative control antibody. RNA Bound equals 100×(net counts bound in the presence of competitor/net counts bound in the absence of competitor).

FIG. 6 shows the results of a competitive ELISA assay in which the binding of soluble LS-Rg to immobilized sialyl-Lewis ^x/BSA conjugates is competed with increasing concentrations of unlabeled F14.12 (SEQ ID NO: 78). Binding of LS-Rg was monitored with an HRP conjugated anti-human IgG antibody. LS-Rg Bound equals 100×(OD ₄₅₀in the presence of competitor)/(OD ₄₅₀in the absence of competitor). The observed OD ₄₅₀was corrected for nonspecific binding by subtracting the OD ₄₅₀in the absence of LS-Rg from the experimental values. In the absence of competitor the OD ₄₅₀was 0.324 and in the absence of LS-Rg 0.052. Binding of LS-Rg requires divalent cations; in the absence of competitor, replacement of Ca ⁺⁺/MgN with 4 mM EDTA reduced the OD ₄₅₀to 0.045.

FIG. 7 shows hairpin secondary structures for representative L-selectin 2′NH ₂RNA ligands: (a) F13.32 (SEQ. ID NO: 67), family I; (b) 6.16 (SEQ. ID NO: 84), family III; and (c) F14.12 (SEQ. ID NO: 78), family II. Nucleotide sequence is in standard one letter code. Invariant nucleotides are in bold type. Nucleotides derived from fixed sequence are in lower case.

FIG. 8 shows a schematic representation of each dimeric and mutimeric oligonucleotide complex: (a) dimeric branched oligonucleotide; (b) multivalent streptavidin/bio-oligonucleotide complex (A: streptavidin; B: biotin); (c) dimeric dumbell oligonucleotide; (d) dimeric fork oligonucleotide.

FIG. 9 shows binding curves for the L-selectin SELEX fifteenth round ssDNA pool to PBMCs (10 ⁷/ml).

FIG. 10 shows the results of a competition experiment in which the binding of 2 nM ³²P-labeled round 15 ssDNA to PBMCs (10 ⁷/ml) is competed with increasing concentrations of the blocking monoclonal anti-L-selectin antibody, DREG-56, or an isotype matched, negative control antibody. RNA Bound equals 100×(net counts bound in the presence of competitor/net counts bound in the absence of competitor).

FIG. 11 shows L-selectin specific binding of LD201T1 (SEQ ID NO: 185) to human lymphocytes and granulocytes in whole blood. a, FITC-LD201T1 binding to lymphocytes is competed by DREG-56, unlabeled LD201T1, and inhibited by EDTA. b, FIFC-LD201T1 binding to granulocytes is competed by DREG-56, unlabeled LD201T1, and inhibited by EDTA. All samples were stained with 0.15 mM FITC-LD201T1; thick line: FITC-LD201T1 only; thick dashed line: FITC-LD201T1 with 0.3 mM DREG-56; medium thick line: FITC-LD201T1 with 7 mM unlabeled NX280; thin line: FITC-LD201T1 stained cells, reassayed after addition of 4 mM EDTA; thin dashed line: autofluorescence.

FIG. 12 shows the consensus hairpin secondary structures for family 1 ssDNA ligands to L-selectin. Nucleotide sequence is in standard one letter code. Invariant nucleotides are in bold type. The base pairs at highly variable positions are designated N-N′. To the right of the stem is a matrix showing the number of occurances of particular base pairs for the position in the stem that is on the same line.

FIG. 13 shows that in vitro pre-treatment of human PBMC with NX288 (SEQ ID NO: 193) inhibits lymphocyte trafficking to SCID mouse PLN. Human PBMC were purified from heparinised blood by a Ficoll-Hypaque gradient, washed twice with HBSS (calcium/magnesium free) and labeled with ⁵¹Cr (Amersharn). After labeling, the cells were washed twice with HBSS (containing calcium and magnesium) and 1% bovine serum albumin (Sigma). Female SCID mice (6-12 weeks of age) were injected intravenously with 2×10 ⁶cells. The cells were either untreated or mixed with either 13 pmol of antibody (DREG-56 or MEL-14), or 4, 1, or 0.4 mmol of modified oligonucleotide. One hour later the animals were anaesthetised, a blood sample taken and the mice were euthanised. PLN, MLN, Peyer's patches, spleen, liver, lungs, thymus, kidneys and bone marrow were removed and the counts incorporated into the organs determined by a Packard gamma counter. Values shown represent the mean ±s.e. of triplicate samples, and are representative of 3 experiments.

FIG. 14 shows that pre-injection of NX288 (SEQ ID NO: 193) inhibits human lymphocyte trafficking to SCID mouse PLN and MLN. Human PBMC were purified, labeled, and washed as described above. Cells were prepared as described in FIG. 13. Female SCID mice (6-12 weeks of age) were injected intravenously with 2×10 ⁶cells. One to 5 min prior to injecting the cells, the animals were injected with either 15 pmol DREG-56 or 4 mmol modified oligonucleotide. Animals were scarificed 1 hour after injection of cells. Counts incorporated into organs were quantified as described in FIG. 13. Values shown represent the mean ±s.e. of triplicate samples, and are representative of 2 experiments.

FIG. 15 shows the consensus hairpin secondary structures for 2′-F RNA ligands to L-selectin. Nucleotide sequence is in standard one letter code. Invariant nucleotides are in bold type. The base pairs at highly variable positions are designated N-N′. To the right of the stem is a matrix showing the number of occurances of particular base pairs for the position in the stem that is on the same line.

FIG. 16 shows the consensus hairpin secondary structures for 2′-F RNA ligands to P-selectin. Nucleotide sequence is in standard one letter code. Invariant nucleotides are in bold type. The base pairs at highly variable positions are designated N-N′. To the right of the stem is a matrix showing the number of occurances of particular base pairs for the position in the stem that is on the same line.

DETAILED DESCRIPTION OF THE INVENTION

This application describes high-affinity nucleic acid ligands to lectins identified through the method known as SELEX. SELEX is described in U.S. patent application Ser. No. 07/536,428, entitled “Systematic Evolution of Ligands by EXponential Enrichment”, now abandoned; U.S. patent application Ser. No. 07/714,131, filed Jun. 10, 1991, entitled “Nucleic Acid Ligands”, now U.S. Pat. No. 5,475,096; U.S. patent application Ser. No. 07/931,473, filed Aug. 17, 1992, entitled “Methods for Identifying Nucleic Acid Ligands”, now U.S. Pat. No. 5,270,163, (see also PCT/US91/04078). These applications, each specifically incorporated herein by reference, are collectively called the SELEX Patent Applications.

In its most basic form, the SELEX process may be defined by the following series of steps:

1) A candidate mixture of nucleic acids of differing sequence is prepared. The candidate mixture generally includes regions of fixed sequences (i.e., each of the members of the candidate mixture contains the same sequences in the same location) and regions of randomized sequences. The fixed sequence regions are selected either: (a) to assist in the amplification steps described below, (b) to mimic a sequence known to bind to the target, or (c) to enhance the concentration of a given structural arrangement of the nucleic acids in the candidate mixture. The randomized sequences can be totally randomized (i.e., the probability of finding a base at any position being one in four) or only partially randomized (e.g., the probability of finding a base at any location can be selected at any level between 0 and 100 percent).

2) The candidate mixture is contacted with the selected target under conditions favorable for binding between the target and members of the candidate mixture. Under these circumstances, the interaction between the target and the nucleic acids of the candidate mixture can be considered as forming nucleic acid-target pairs between the target and those nucleic acids having the strongest affinity for the target.

3) The nucleic acids with the highest affinity for the target are partitioned from those nucleic acids with lesser affinity to the target. Because only an extremely small number of sequences (and possibly only one molecule of nucleic acid) corresponding to the highest affinity nucleic acids exist in the candidate mixture, it is generally desirable to set the partitioning criteria so that a significant amount of the nucleic acids in the candidate mixture (approximately 0.05-50%) are retained during partitioning.

4) Those nucleic acids selected during partitioning as having the relatively higher affinity to the target are then amplified to create a new candidate mixture that is enriched in nucleic acids having a relatively higher affinity for the target.

5) By repeating the partitioning and amplifying steps above, the newly formed candidate mixture contains fewer and fewer unique sequences, and the average degree of affinity of the nucleic acids to the target will generally increase. Taken to its extreme, the SELEX process will yield a candidate mixture containing one or a small number of unique nucleic acids representing those nucleic acids from the original candidate mixture having the highest affinity to the target molecule.

The SELEX Patent Applications describe and elaborate on this process in great detail. Included are targets that can be used in the process; methods for partitioning nucleic acids within a candidate mixture; and methods for amplifying partitioned nucleic acids to generate enriched candidate mixture. The SELEX Patent Applications also describe ligands obtained to a number of target species, including both protein targets where the protein is and is not a nucleic acid binding protein.

This invention also includes the ligands as described above, wherein certain chemical modifications are made in order to increase the in vivo stability of the ligand or to enhance or mediate the delivery of the ligand. Examples of such modifications include chemical substitutions at the sugar and/or phosphate and/or base positions of a given nucleic acid sequence. See, e.g., U.S. patent application Ser. No. 08/117,991, filed Sep. 9 Sep. 8, 1993, entitled “High Affinity Nucleic Acid Ligands Containing Modified Nucleotides” which is specifically incorporated herein by reference. Additionally, in co-pending and commonly assigned U.S. patent application Ser. No. 07/964,624, filed Oct. 21, 1992 ('624), now U.S. Pat. No. 5,496,938, methods are described for obtaining improved nucleic acid ligands after SELEX has been performed. The '624 application, entitled “Methods of Producing Nucleic Acid Ligands to HIV-RT and HIV-1 Rev” is specifically incorporated herein by reference. Further included in the '624 patent are methods for determining the three dimensional structures of nucleic acid ligands. Such methods include mathematical modeling and structure modifications of the SELEX-denved ligands, such as chemical modification and nucleotide substitution. Other modifications are known to one of ordinary skill in the art. Such modifications may be made post-SELEX (modification of previously identified unmodified ligands) or by incorporation into the SELEX process. Additionally, the nucleic acid ligands of the invention can be complexed with various other compounds, including but not limited to, lipophilic compounds or non-immunogenic, high molecular weight compounds. Lipophilic compounds include, but are not limited to, cholesterol, dialkyl glycerol, and diacyl glycerol. Non-immunogenic, high molecular weight compounds include, but are not limited to, polyethylene glycol, dextran, albumin and magnetite. The nucleic acid ligands described herein can be complexed with a lipophilic compound (e.g., cholesterol) or attached to or encapsulated in a complex comprised of lipophilic components (e.g., a liposome). The complexed nucleic acid ligands can enhance the cellular uptake of the nucleic acid ligands by a cell for delivery of the nucleic acid ligands to an intracellular target. The complexed nucleic acid ligands can also have enhanced pharmacokinetics and stability. U.S. patent application Ser. No. 08/434,465, filed May 4, 1995, entitled “Nucleic Acid Ligand Complexes”, now U.S. Pat. No. 6,011,020, which is herein incorporated by reference describes a method for preparing a therapeutic or diagnostic complex comprised of a nucleic acid ligand and a lipophilic compound or a non-immunogenic, high molecular weight compound.

The methods described herein and the nucleic acid ligands identified by such methods are useful for both therapeutic and diagnostic purposes. Therapeutic uses include the treatment or prevention of diseases or medical conditions in human patients. Many of the therapeutic uses are described in the background of the invention, particularly, nucleic acid ligands to selectins are useful as anti-inflammatory agents. Antagonists to the selectins modulate extravasion of leukocytes at sites of inflammation and thereby reduce neutrophil caused host tissue damage. Diagnostic utilization may include both in vivo or in vitro diagnostic applications. The SELEX method generally, and the specific adaptations of the SELEX method taught and claimed herein specifically, are particularly suited for diagnostic applications. SELEX identifies nucleic acid ligands that are able to bind targets with high affinity and with surprising specificity. These characteristics are, of course, the desired properties one skilled in the art would seek in a diagnostic ligand.

The nucleic acid ligands of the present invention may be routinely adapted for diagnostic purposes according to any number of techniques employed by those skilled in the art. Diagnostic agents need only be able to allow the user to identify the presence of a given target at a particular locale or concentration. Simply the ability to form binding pairs with the target may be sufficient to trigger a positive signal for diagnostic purposes. Those skilled in the art would also be able to adapt any nucleic acid ligand by procedures known in the art to incorporate a labeling tag in order to track the presence of such ligand. Such a tag could be used in a number of diagnostic procedures. The nucleic acid ligands to lectin, particularly selecting, described herein may specifically be used for identification of the lectin proteins.

SELEX provides high affinity ligands of a target molecule. This represents a singular achievement that is unprecedented in the field of nucleic acids research. The present invention applies the SELEX procedure to lectin targets. Specifically, the present invention describes the identification of nucleic acid ligands to Wheat Germ Agglutinin, and the selectins, specifically, L-selectin, P-selectin and E-selectin. In the Example section below, the experimental parameters used to isolate and identify the nucleic acid ligands to lectins are described.

In order to produce nucleic acids desirable for use as a pharmaceutical, it is preferred that the nucleic acid ligand (1) binds to the target in a manner capable of achieving the desired effect on the target; (2) be as small as possible to obtain the desired effect; (3) be as stable as possible; and (4) be a specific ligand to the chosen target. In most situations, it is preferred that the nucleic acid ligand have the highest possible affinity to the target.

In the present invention, a SELEX experiment was performed in search of nucleic acid ligands with specific high affinity for Wheat Germ Agglutinin from a degenerate library containing 50 random positions (50N). This invention includes the specific nucleic acid ligands to Wheat Germ Agglutinin shown in Table 2 (SEQ ID NOS: 4-55), identified by the methods described in Examples 1 and 2. Specifically, RNA ligands containing 2′-NH ₂modified pyrimidines are provided. The scope of the ligands covered by this invention extends to all nucleic acid ligands of Wheat Germ Agglutinin, modified and unmodified, identified according to the SELEX procedure. More specifically, this invention includes nucleic acid sequences that are substantially homologous to the ligands shown in Table 2. By substantially homologous it is meant a degree of primary sequence homology in excess of 70%, most preferably in excess of 80%. A review of the sequence homologies of the ligands of Wheat Germ Agglutinin shown in Table 2 shows that sequences with little or no primary homology may have substantially the same ability to bind Wheat Germ Agglutinin. For these reasons, this invention also includes nucleic acid ligands that have substantially the same ability to bind Wheat Germ Agglutinin as the nucleic acid ligands shown in Table 2. Substantially the same ability to bind Wheat Germ Agglutinin means that the affinity is within a few orders of magnitude of the affinity of the ligands described herein. It is well within the skill of those of ordinary skill in the art to determine whether a given sequence—substantially homologous to those specifically described herein—has substantially the same ability to bind Wheat Germ Agglutitin.

In the present invention, SELEX experiments were performed in search of nucleic acid ligands with specific high affinity for L-selectin from degenerate libraries containing 30 or 40 random positions (30N or 40N). This invention includes the, specific nucleic acid ligands to L-selectin shown in Tables 8, 12 and 16 (SEQ ID NOS: 67-117, 129-180, 185-196 and 293-388), identified by the methods described in Examples 7, 8, 13, 14, 22 and 23. Specifically, RNA ligands containing 2′-NH ₂or 2′-F pyrimidines and ssDNA ligands are provided. The scope of the ligands covered by this invention extends to all nucleic acid ligands of L-selectin, modified and unmodified, identified according to the SELEX procedure. More specifically, this invention includes nucleic acid sequences that are substantially homologous to the ligands shown in Tables 8, 12 and 16. By substantially homologous it is meant a degree of primary sequence homology in excess of 70%, most preferably in excess of 80%. A review of the sequence homologies of the ligands of L-selectin shown in Tables 8, 12 and 16 shows that sequences with little or no primary homology may have substantially the same ability to bind L-selectin. For these reasons, this invention also includes nucleic acid ligands that have substantially the same ability to bind L-selectin as the nucleic acid ligands shown in Tables 8, 12 and 16. Substantially the same ability to bind L-selectin means that the affinity is within a few orders of magnitude of the affinity of the ligands described herein. It is well within the skill of those of ordinary skill in the art to determine whether a given sequence—substantially homologous to those specifically described herein—has substantially the same ability to bind L-selectin.

In the present invention, SELEX experiments were performed in search of nucleic acid ligands with specific high affinity for P-selectin from degenerate libraries containing 50 random positions (50N). This invention includes the specific nucleic acid ligands to P-selectin shown in Tables 19 and 25 (SEQ ID NOS: 199-247 and 251-290), identified by the methods described in Examples 27, 28, 35 and 36. Specifically, RNA ligands containing 2′-NH ₂and 2′-F pyrimidines are provided. The scope of the ligands covered by this invention extends to all nucleic acid ligands of P-selectin, modified and unmodified, identified according to the SELEX procedure. More specifically, this invention includes nucleic acid sequences that are substantially homologous to the ligands shown in Tables 19 and 25. By substantially homologous it is meant a degree of primary sequence homology in excess of 70%, most preferably in excess of 80%. A review of the sequence homologies of the ligands of P-selectin shown in Tables 19 and 25 shows that sequences with little or no primary homology may have substantially the same ability to bind P-selectin. For these reasons, this invention also includes nucleic acid ligands that have substantially the same ability to bind P-selectin as the nucleic acid ligands shown in Tables 19 and 25. Substantially the same ability to bind P-selectin means that the affinity is within a few orders of magnitude of the affinity of the ligands described herein. It is well within the skill of those of ordinary skill in the art to determine whether a given sequence—substantially homologous to those specifically described herein—has substantially the same ability to bind P-selectin.

In the present invention, a SELEX experiment was performed in search of nucleic acid ligands with specific high affinity for E-selectin from a degenerate library containing 40 random positions (40N). This invention includes specific nucleic acid ligands to E-selectin identified by the methods described in Example 40. The scope of the ligands covered by this invention extends to all nucleic acid ligands of E-selectin, modified and unmodified, identified according to the SELEX procedure.

Additionally, the present invention includes multivalent Complexes comprising the nucleic acid ligands of the invention. The mulivalent Complexes increase the binding energy to facilitate better binding affinities through slower off-rates of the nucleic acid ligands. The multivalent Complexes may be useful at lower doses than their monomeric counterparts. In addition, high molecular weight polyethylene glycol was included in some of the Complexes to decrease the in vivo clearance rate of the Complexes. Specifically, nucleic acid ligands to L-selectin were placed in multivalent Complexes.

As described above, because of their ability to selectively bind lectins, the nucleic acid ligands to lectins described herein are useful as pharmaceuticals. This invention, therefore, also includes a method for treating lectin-mediated diseases by administration of a nucleic acid ligand capable of binding to a lectin.

Therapeutic compositions of the nucleic acid ligands may be administered parenterally by injection, although other effective administration forms, such as intraarticular injection, inhalant mists, orally active formulations, transdermal iontophoresis or suppositories, are also envisioned. One preferred carrier is physiological saline solution, but it is contemplated that other pharmaceutically acceptable carriers may also be used. In one preferred embodiment, it is envisioned that the carrier and the ligand constitute a physiologically-compatible, slow release formulation. The primary solvent in such a carrier may be either aqueous or non-aqueous in nature. In addition, the carrier may contain other pharmacologically-acceptable excipients for modifying or maintaining the pH, osmolarity, viscosity, clarity, color, sterility, stability, rate of dissolution, or odor of the formulation. Similarly, the carrier may contain still other pharmacologically-acceptable excipients for modifying or maintaining the stability, rate of dissolution, release, or absorption of the ligand. Such excipients are those substances usually and customarily employed to formulate dosages for parental administration in either unit dose or multi-dose form.

Once the therapeutic composition has been formulated, it may be stored in sterile vials as a solution, suspension, gel, emulsion, solid, or dehydrated or lyophilized powder. Such formulations may be stored either in a ready to use form or requiring reconstitution immediately prior to administration. The manner of administering formulations containing nucleic acid ligands for systemic delivery may be via subcutaneous, intramuscular, intravenous, intranasal or vaginal or rectal suppository.

Well established animal models exist for many of the disease states which are candidates for selectin antagonist therapy. Models available for testing the efficacy of oligonucleotide selectin antagonists include:

1) mouse models for peritoneal inflammation (P. Pizcueta and F. W. Luscinskas, 1994, Am. J. Pathol. 145, 461-469), diabetes (A. C. Hanninen et al., 1992, J. Clin. Invest. 92, 2509-2515), lymphocyte trafficking (L. M. Bradley et al., 1994, J. Exp. Med., 2401-2406), glomerulonephritis (P. G. Tipping et al., 1994, Kidney Int. 46, 79-88), experimental allergic encephalomyelitis (J. M. Dopp et al., 1994, J. Neuroimmunol. 54: 129-144), acute inflammation in human/SCID mouse chimera (H.-C. Yan et al., 1994, J. Immunol. 152, 3053-3063), endotoxin-mediated inflammation (W. E. Sanders et al., 1992, Blood 80, 795-800);

2) rat models for acute lung injury (M. S. Milligan et al., 1994, J. Immunol. 152, 832-840), hind limb ischermia/reperfusion injury (A. Seekamp et al., 1994, Am. J. Pathol 144, 592-598), remote lung injury (A. Seekamp et al., 1994, supra; D. L. Carden et al., 1993, J. Appl. Physiol 75, 2529-2543), neutrophil rolling on mesenteric venules (K. Ley et al., 1993, Blood 82, 1632-1638), myocardial infarction ischemia reperfusion injury (D. Altavilla et al., 1994, Eur. J. Pharmacol. Environ. Toxicol. Pharmacol. 270, 45-51);

3) rabbit models for hemorrhagic shock (R. K. Winn et al., 1994, Am. J. Physiol. Heart Circ. Physiol. 267, H2391-H2397), ear ischemia reperfusion injury (D. Mihelcic et al., 1994, Bollod 84, 2333-2328) neutrophil rolling on mesenteric venules (A. M. Olofsson et al., Blood 84, 2749-2758), experimental meningitis (C. Granert et al., 1994, J. Clin. Invest. 93, 929-936); lung, peritoneal and subcutaneous bacterial infection (S. R. Sharer et al., 1993, J. Immunol. 151, 4982-4988), myocardial ischemia/repefusion (G. Montrucchio et al., 1989, Am. J. Physiol. 256, H1236-H1246), central nervous system ischermic injury (W. M. Clark et al., 1991, Stroke 22, 877-883);

4) cat models for myocardial infraction ischemia reperfusion injury (M. Buerke et al., 1994, J. Pharmacol. Exp. Ther. 271, 134-142);

5) dog models for myocardial infarction ischemia reperfusion injury (D. J. Lefer et al., 1994, Circulation 90, 2390-2401);

6) pig models for arthritis (F. Jamar et al., 1995, Radiology 194, 843-850);

7) rhesus monkey models for cutaneous inflammation (A. Silber et al., Lab. Invest. 70, 163-175);

8) cynomolgus monkey models for renal transplants (S.-L. Wee, 1991, Transplant. Prod. 23, 279-280); and

9) baboon models for dacron grafts (T. Palabrica et al, 1992, Nature 359, 848-851), septic, traumatic and hypovolemic shock (H. Redl et al., 1991, Am. J. Pathol. 139, 461-466).

The nucleic acid ligands to lectins described herein are useful as pharmaceuticals and as diagnostic reagents.

EXAMPLES

The following examples are illustrative of certain embodiments of the invention and are not to be construed as limiting the present invention in any way. Examples 1-6 describe identification and characterization of 2′-NH ₂RNA ligands to Wheat Germ Agglutinin. Examples 7-12 described identification and characterization of 2′-NH ₂RNA ligands to L-selectin. Examples 13-21 describe identification and characterization of ssDNA ligands to L-selectin. Examples 22-25 describe identification and characterization of 2′-F RNA ligands to L-selectin. Example 26 describes identification of ssDNA ligands to P-selectin. Examples 27-39 describes identification and characterization of 2′-NH ₂and 2′-F RNA ligands to P-selectin. Example 40 describes identification of nucleic acid ligands to E-selectin.

Example 1

Nucleic Acid Ligands to Wheat Germ Agglutinin

The experimental procedures outlined in this Example were used to identify and characterize nucleic acid ligands to wheat germ agglutinin (WGA) as described in Examples 2-6.

Experimental Procedures

A) Materials

Wheat Germ Lectin ( Triticum vulgare ) Sepharose 6 MB beads were purchased from Pharmacia Biotech. Wheat Germ Lectin, Wheat Germ Agglutinin, and WGA are used interchangeably herein. Free Wheat Germ Lectin ( Triticum vulgare ) and all other lectins were obtained from E Y Laboratories; methyl-α-D- mannopyranoside was from Calbiochem and N-acetyl-D-glucosamnine, GlcNAc, and the trisaccharide N N′N′-triacetylchitotriose, (GlcNAc) ₃, were purchased from Sigma Chemical Co. The 2′-NH ₂modified CTP and UTP were prepared according to Pieken et. al. (1991, Science 253:314-317). DNA oligonucleotides were synthesized by Operon. All other reagents and chemicals were purchased from commercial sources. Unless otherwise indicated, experiments utilized Hanks' Balanced Salt Solutions (HBSS; 1.3 mM CaCl ₂, 5.0 mM KCl, 0.3 nM KH ₂PO ₄, 0.5 mM MgCl ₂.6H ₂O, 0.4 mM MgSO ₄.7H ₂O, 138 mM NaCl, 4.0 mM NaHCO ₃, 0.3 mM Na ₂HPO ₄, 5.6 mM D-Glucose; GibcoBRL).

B) SELEX

The SELEX procedure is described in detail in U.S. Pat. No. 5,270,163 and elsewhere. In the wheat germ agglutinin SELEX experiment, the DNA template for the initial RNA pool contained 50 random nucleotides, flanked by N9 5′ and 3′ fixed regions (50N9) 5′ gggaaaagcgaaucauacacaaga-50N-gcuccgccagagaccaaccgagaa 3′ (SEQ ID NO: 1). All C and U have 2′-NH ₂substituted for 2′-OH for ribose. The primers for the PCR were the following: 5′ Primer 5′ taatacgactcactatagggaaaagcgaatcatacacaaga 3′ (SEQ ID NO: 2) and 3′ Primer 5′ ttctcggttggtctctggcggagc 3′ (SEQ ID NO: 3). The fixed regions of the starting random pool include DNA primer annealing sites for PCR and cDNA synthesis as well as the consensus T7 promoter region to allow in vitro transcription. These single-stranded DNA molecules were converted into double-stranded transcribable templates by PCR amplification. PCR conditions were 50 mM KCl, 10 mM Tris-Cl, pH 8.3, 0.1% Triton X-100, 7.5 mM MgCl ₂, 1 mM of each dATP, dCTP, dGTP, and dTTP, and 25 U/ml of Taq DNA polymerase. Transcription reactions contained 5 mM DNA template, 5 units/μl T7 RNA polymerase, 40 mM Tris-Cl (pH 8.0), 12 mM MgCl ₂, 5 mM DTT, 1 mM spermidine, 0.002% Triton X-100, 4% PEG 8000, 2 mM each of 2′-OH ATP, 2′-OH GTP, 2′-NH ₂CTP, 2′-NH ₂UTP, and 0.31 mM α- ³²P 2′-OH ATP.

The strategy for partitioning WGA/RNA complexes from unbound RNA was 1) to incubate the RNA pool with WGA immobilized on sepharose beads; 2) to remove unbound RNA by extensive washing; and 3) to specifically elute RNA molecules bound at the carbohydrate binding site by incubating the washed beads in buffer containing high concentrations of (GlcNAc) ₃. The SELEX protocol is outlined in Table 1.

The WGA density on Wheat Germ Lectin Sepharose 6 MB beads is approximately 5 mg/ml of gel or 116 μM (manufacturer's specifications). After extensive washing in HBSS, the immobilized WGA was incubated with RNA at room temperature for 1 to 2 hours in a 2 ml siliconized column with constant rolling (Table 1). Unbound RNA was removed by extensive washing with HBSS. Bound RNA was eluted as two fractions; first, nonspecifically eluted RNA was removed by incubating and washin; with 10 mM methyl-α-D-mannopyranoside in HBSS (Table 1; rounds 14) or with HBSS (Table 1; rounds 5-11); second, specifically eluted RNA was removed by incubating and washing with 0.5 to 10 mM (GlcNAc) ₃in HBSS (Table 1). The percentage of input RNA that was specifically eluted is recorded in Table 1.

The specifically eluted fraction was processed for use in the following round. Fractions eluted from immobilized WGA were heated at 90° C. for 5 minutes in 1% SDS, 2% β-mercaptoethanol and extracted with phenol/chloroform. RNA was reverse transcribed into cDNA by AMV reverse transcriptase at 48° C. for 60 min in 50 mM Tris-Cl pH (8.3), 60 mM NaCl, 6 mM Mg(OAc) ₂, 10 mM DTT, 100 pmol DNA primer, 0.4 mM each of dNTPs, and 0.4 unit/μl AMV RT. PCR amplification of this cDNA resulted in approximately 500 pmol double-stranded DNA, transcripts of which were used to initiate the next round of SELEX.

D) Nitrocellulose Filter Binding Assay

As described in SELEX Patent Applications, a nitrocellulose filter partitioning method was used to determine the affinity of RNA ligands for WGA and for other proteins. Filter discs (nitroceliulose/cellulose acetate mixed matrix, 0.45 μm pore size, Millipore; or pure nitrocellulose, 0.45 μm pore size, Bio-Rad) were placed on a vacuum manifold and washed with 4 ml of HBSS buffer under vacuum. Reaction mixtures, containing ³²P labeled RNA pools and unlabeled WGA, were incubated in HBSS for 10 min at room temperature, filtered, and then immediately washed with 4 ml HBSS. The filters were air-dried and counted in a Beckman LS6500 liquid scintillation counter without fluor.

WGA is a homodimer, molecular weight 43.2 kD, with 4 GlcNAc binding sites per dimer. For affinity calculations, we assume one RNA ligand binding site per monomer (two per dimer). The monomer concentration is defined as 2 times the dimer concentration. The equilibrium dissociation constant, K _d, for an RNA pool or specific ligand that binds monophasically is given by the equation
K _d=[P _f][R _f]/[RP]

- where, [Rf]=free RNA concentration
  - [Pf]=free WGA monomer concentration
  - [RP]=concentration of RNA/WGA monomer complexes
  - K _d=dissociation constant
    A rearrangement of this equation, in which the fraction of RNA bound at equilibrium is expressed as a function of the total concentration of the reactants, was used to calculate Kds of monophasic binding curves:
    q =( P _T +R _T +K _d−(( P _T +R _T +K _d) ²−4 P _T R _T) ^1/2)
- q=fraction of RNA bound
- [P _T]=total WGA monomer concentration
- [R _T]=total RNA concentration
  K _ds were determined by least square fitting of the data points using the graphics program Kaleidagraph (Synergy Software, Reading, Pa.).
  E) Cloning and Sequencing

The sixth and eleventh round PCR products were re-amplified with primers which contain a BamH1 or a EcoR1 restriction endonuclease recognition site. Using these restriction sites the DNA sequences were inserted directionally into the pUC18 vector. These recombinant plasmids were transformed into E. coli strain JM109 (Stratagene, La Jolla, Calif.). Plasmid DNA was prepared according to the alkaline hydrolysis method (Zhou et al., 1990 Biotechniques 8:172-173) and about 72 clones were sequenced using the Sequenase protocol (United States Biochemical Corporation, Cleveland, Ohio). The sequences are provided in Table 2.

F) Competitive Binding Studies

Competitive binding experiments were performed to determine if RNA ligands and (GlcNAc) ₃bind the same site on WGA. A set of reaction mixtures containing α ³²P labeled RNA ligand and unlabeled WGA, each at a fixed concentration (Table 5), was incubated in HBSS for 15 min at room temperature with (GlcNAc) ₃. Individual reaction mixtures were then incubated with a (GlcNAc) ₃dilution from a 2-fold dilution series for 15 minutes. The final (GlcNAc) ₃concentrations ranged from 7.8 μM to 8.0 mM (Table 5). The reaction mixtures were filtered, processed and counted as described in “Nitrocellulose Filter Binding Assay,” paragraph D above.

Competition titration experiments were analyzed by the following equation to determine the concentration of free protein [P] as a function of the total concentration of competitor added, [C _T]:
0 =[P ](1 +K _L [L _T]/(1 +K _L [P ])+ K _C [C _T]/(1 +K _C [P ]))− P _T
where L _Tis the concentration of initial ligand, K _Lis the binding constant of species L to the protein (assuming 1:1 stiochiometry) and K _Cis the binding constant of species C to the protein (assuming 1:1 stiochiometry). Since it is difficult to obtain a direct solution for equation 1, iteration to determine values of [P] to a precision of 1×10 ⁻¹⁵was used. Using these values of [P], the concentration of protein-ligand complex [PL] as a function of [C _T] was determined by the following equation:
[PL]=K _L [L _T ][P ](1 +K _L [P ])
Since the experimental data is expressed in terms of % [PL], the calculated concentration of [PL] was normalized by the initial concentration of [PL _o] before addition of the competitor. ([PL _o] was calculated using the quadratic solution for the standard binding equation for the conditions used. The maximum (M) and minimum (B) % [PL] was allowed to float during the analysis as shown in the following equation.
% [ PL]=[PL]/[PL _o]*( M−B )+ B
A non-linear least-squares fitting procedure was used as described by P. R. Bevington (1969) Data Reduction and Error Analysis for the Physical Sciences, McGraw-Hill publishers. The program used was originally written by Stanley J. Gill in MatLab and modified for competition analysis by Stanley C. Gill. The data were fit to equations 1-3 to obtain best fit parameters for K _C, M and B as a function of [C _T] while leaving K _Land P _Tfixed.
G) Inhibition of WGA Agglutinating Activity

Agglutination is a readily observed consequence of the interaction of a lectin with cells and requires that individual lectin molecules crosslink two or more cells. Lectin mediated agglutination can be inhibited by sugars with appropriate specificity. Visual assay of the hemagglutinating activity of WGA and the inhibitory activity of RNA ligands, GlcNAc and (GlcNAc) ₃was made in Falcon round bottom 96 well microtiter plates; using sheep erythrocytes. Each well contained 54 μl of erythrocytes (2.5×10 ⁸cells/ml) and 54 μl of test solution.

To titrate WGA agglutinating activity, each test solution contained a WGA dilution from a 4-fold dilution series. The final WGA concentrations ranged from 0.1 μM to 0.5 μM. For inhibition assays, the test solutions contained 80 nM WGA (monomer) and a dilution from a 4-fold dilution series of the designated inhibitor. Reaction mixtures were incubated at room temperature for 2 hours, after which time no changes were observed in the precipitation patterns of erythrocytes. These experiments were carried out in Gelatin Veronal Buffer (0.15 mM CaCl ₂, 141 mM NaCl, 0.5 mM MgCl ₂, 0.1% gelatin, 1.8 mM sodium barbital, and 3.1 mM barbituric acid, pH 7.3-7.4; Sigma #G-6514).

In the absence of agglutination, erythrocytes settle as a compact pellet. Agglutinated cells form a more diffuse pellet. Consequently, in visual tests, the diameter of the pellet is diagnostic for agglutination. The inhibition experiments included positive and negative controls for agglutination and appropriate controls to show that the inhibitors alone did not alter the normal precipitation pattern.

Example 2

RNA Ligands to WGA

A. SELEX

The starting RNA library for SELEX, randomized 50N9 (SEQ ID NO: 1), contained approximately 2×10 ¹⁵molecules (2 mmol RNA). The SELEX protocol is outlined in Table 1. Binding of randomized RNA to WGA is undetectable at 36 μM WGA monomer. The dissociation constant of this interaction is estimated to be >4 mM.

The percentage of input RNA eluted by (GlcNAc) ₃increased from 0.05% in the first round, to 28.5% in round 5 (Table 1). The bulk K _dof round 5 RNA was 600 nM (Table 1). Since an additional increase in specifically eluted RNA was not observed in round 6a (Table 1), round 6 was repeated (Table 1, round 6b) with two modifications to increase the stringency of selection: the volume of gel, and hence the mass of WGA, was reduced ten fold; and RNA was specifically eluted with increasing concentrations of (GlcNAc) ₃, in stepwise fashion, with only the last eluted RNA processed for the following round. The percentage of specifically eluted RNA increased from 5.7% in round 6b to 21.4% in round 8, with continued improvement in the bulk K _d(260 nM, round 8 RNA, Table 1).

For rounds 9 through 11, the WGA mass was again reduced ten fold to further increase stringency. The K _dof round 11 RNA was 68 nM. Sequencing of the bulk starting RNA pool and sixth and eleventh round RNA revealed some nonrandomness in the variable region at the sixth round and increased nonrandomess at round eleven.

To monitor the progess of SELEX, ligands were cloned and sequenced from round 6b and round 11. From each of the two rounds, 36 randomly picked clones were sequenced. Sequences were aligned manually and are shown in Table 2.

B. RNA Sequences

From the sixth and eleventh rounds, respectively, 27 of 29 and 21 of 35 sequenced ligands were unique. The number before the “.” in the ligand name indicates whether it was cloned from the round 6 or round 11 pool. Only a portion of the entire clone is shown in Table 2 (SEQ ID NOS: 4-55). The entire evolved random region is shown in upper case letters. Any portion of the fixed region is shown in lower case letters. By definition, each clone includes both the evolved sequence and the associated fixed region, unless specifically stated otherwise. A unique sequence is operationally defined as one that differs from all others by three or more nucleotides. In Table 2, ligands sequences are shown in standard single letter code (Cornish-Bowden, 1985 NAR 13: 3021-3030). Sequences that were isolated more than once are indicated by the parenthetical number, (n), following the ligand isolate number. These clones fall into nine sequence families (1-9) and a group of unrelated sequences (Orphans).

The distribution of families from round six to eleven provides a clear illustration of the appearance and disappearance of ligand families in response to increased selective pressure (Table 2). Family 3, predominant (11/29 ligands) in round 6, has nearly disappeared (2/35) by round 11. Similarly, minor families 6 through 9 virtually disappear. In contrast, only one (family 1) of round eleven's predominant families (1, 2, 4 and 5) was detected in round six. The appearance and disappearance of families roughly correlates with their binding affinities.

Alignment (Table 2) defines consensus sequences for families 14 and 6-9 (SEQ ID NOS: 56-63). The consensus sequences of families 1-3 are long (20, 16 and 16, respectively) and very highly conserved. The consensus sequences of families 1 and 2 contain two sequences in common: the trinucleotide TCG and the pentanucleotide ACGAA. A related tetranucleotide, AACG, occurs in family 3. The variation in position of the consensus sequences within the variable regions indicates that the ligands do not require a specific sequence from either the 5′ or 3′ fixed region.

The consensus sequences of family 1 and 2 are flanked by complementary sequences 5 or more nucleotides in length. These complementary sequences are not conserved and the majority include minor discontinuities. Family 3 also exhibits flanking complementary sequences, but these are more variable in length and structure and utilize two nucleotide pairs of conserved sequence.

Confidence in the family 4 consensus sequence (Table 2) is limited by the small number of ligands, the variability of spacing and the high G content. The pentanucleotide, RCTGG, also occurs in families 5 and 8. Ligands of family 5 show other sequence similarities to those of family 4, especially to ligand 11.28.

C. Affinities

The dissociation constants for representative members of families 1-9 and orphan ligands were determined by nitrocellulose filter binding experiments and are listed in Table 3. These calculations assume one RNA ligand binding site per WGA monomer. At the highest WGA concentration tested (36 μM WGA monomer), binding of random RNA is not observed, indicating a K _dat least 100-fold higher than the protein concentration or >4 mM.

The data in Table 3 define several characteristics of ligand binding. First, RNA ligands to WGA bind monophasically. Second, the range of measured dissociation constants is 1.4 nM to 840 nM. Third, the binding for a number of ligands, most of which were sixth round isolates, was less than 5% at the highest WGA concentration tested. The dissociation constants of these ligands are estimated to be greater than 20 μM. Fourth, on average eleventh round isolates have higher affinity than those from the sixth round. Fifth, the SELEX probably was not taken to completion; the best ligand (11.20)(SEQ ID NO: 40) is not the dominant species. Since the SELEX was arbitrarily stopped at the 11th round, it is not clear that 11.20 would be the ultimate winner. Sixth, even though the SELEX was not taken to completion, as expected, RNA ligands were isolated that bind WGA with much greater affinity than do mono- or oligosaccharides (ie., the affinity of 11.20 is 5×10 ⁵greater than that of GlcNAc, K _d=760 μM, and 850 better than that of (GlcNAc) ₃, K _d=12 μM; Y. Nagata and M. Burger, 1974, supra). This observation validates the proposition that competitive elution allows the isolation of oligonucleotide ligands with affinities that are several orders of magnitude greater than that of the competing sugar.

In addition these data show that even under conditions of high target density, 116 pmol WGA dimer/μl of beads, it is possible to overcome avidity problems and recover ligands with nanomolar affinities. From the sixth to the eleventh round (Table 2), in response to increased selective pressure as indicated by the improvement in bulk K _d(Table 1), sequence families with lower than average affinity (Table 3) are eliminated from the pool.

Example 3

Specificity of RNA Ligands to WGA

The affinity of WGA ligands 6.8, 11.20 and 11.24 (SEQ ID NOS: 13, 40, and 19) for GlcNAc binding lectins from Ulex europaeus, Datura stramonium and Canavalia ensiformis were determined by nitrocellulose partitioning. The results of this determination are shown in Table 4. The ligands are highly specific for WGA. For example, the affinity of ligand 11.20 for WGA is 1,500, 8,000 and >15,000 fold greater than it is for the U. europaeus, D. stramonium and C. ensifornis lectins, respectively. The 8,000 fold difference in affinity for ligand 11.20 exhibited by T. vulgare and D. stramonium compares to a 3 to 10 fold difference in their affinity for oligomers of GlcNAc and validates the proposition that competitive elution allows selection of oligonucleotide ligands with much greater specificity than monomeric and oligomeric saccharides (J. F. Crowley et al., 1984, Arch. Biochem. and Biophys. 231:524-533; Y. Nagata and M. Burger, 1974, supra; J-P. Privat et al., FEBS Letters 46:229-232).

Example 4

Competitive Binding Studies

If an RNA ligand and a carbohydrate bind a common site, then binding of the RNA ligand is expected to be competitively inhibited by the carbohydrate. Furthermore, if the oligonucleotide ligands bind exclusively to carbohydrate binding sites, inhibition is expected to be complete at high carbohydrate concentrations. In the experiments reported in Table 5, dilutions of unlabeled (GlcNAc) ₃, from a 2-fold dilution series, were added to three sets of binding reactions that contained WGA and an α- ³²P labeled RNA ligand (6.8, 11.20 or 11.24 (SEQ ID NOS: 13, 40 and 19); [RNA] _final=[WGA] _final=15 nM). After a 15 minute incubation at room temperature, the reactions were filtered and processed as in standard binding experiments.

Qualitatively, it is clear that RNA ligands bind only to sites at which (GlcNAc) ₃binds, since inhibition is complete at high (GlcNAc) ₃concentrations (Table 5). These data do not rule out the possibility that (GlcNAc) ₃binds one or more sites that are not bound by these RNA ligands.

Quantitatively, these data fit a simple model of competitive inhibition (Table 5) and give estimates of 8.4, 10.9 and 19.4 μM for the K _dof (GlcNAc) ₃. These estimates are in good agreement with literature values (12 μM @ 4 C, Nagata and Burger, 1974, supra; 11 μM @ 10.8 C, Van Landschoot et al., 1977, Eur. J. Biochem. 79:275-283; 50 μM, M. Monsigny et al., 1979, Eur J. Biochem. 98:39-45). These data confirm the proposition that competitive elution with a specific carbohydrate targets the lectin's carbohydrate binding site.

Example 5

Inhibition of WGA Agglutinating Activity

At 0.5 μM, RNA ligands 6.8 and 11.20 (SEQ ID NO: 13 and 40) completely inhibit WGA mediated agglutination of sheep erythrocytes (Table 6). Ligand 11.24 (SEQ ID NO: 19) is not as effective, showing only partial inhibition at 2 μM, the highest concentration tested (Table 6). (GlcNAc) ₃and GlcNAc completely inhibit agglutination at higher concentrations, 8 μM and 800 μM, respectively, (Table 6; Monsigny et al., supra). The inhibition of agglutination varifies the proposition that ligands isolated by this procedure will be antagonists of lectin function. Inhibition also suggests that more than one RNA ligand is bound per WGA dimer, since agglutination is a function of multiple carbohydrate binding sites.

An alternative interpretation for the inhibition of agglutination is that charge repulsion prevents negatively charged WGA/RNA complexes from binding carbohydrates (a necessary condition for agglutination) on negatively charged cell surfaces. This explanation seems unlikely for two reasons. First, negatively charged oligonucleotide ligands selected against an immobilized purified protein are known to bind to the protein when it is presented in the context of a cell surface (see Example 10, L-selectin cell binding). Second, negatively charged (pI=4) succinylated WGA is as effective as native WGA (pI=8.5) in agglutinating erythrocytes (M. Monsigny et al., supra).

Example 6

Secondary Structure of High Affinity WGA Ligands

In favorable instances, comparative analysis of aligned sequences allows deduction of secondary structure and structure-function relationships. If the nucleotides at two positions in a sequence covary according to Watson-Crick base pairing rules, then the nucleotides at these positions are apt to be paired. Nonconserved sequences, especially those that vary in length are not apt to be directly involved in function, while highly conserved sequence are likely to be directly involved.

Comparative analyses of both family 1 and 2 sequences each yield a hairpin structure with a large, highly conserved loop (FIGS. 1 a and 1 b ). Interactions between loop nucleotides are likely but they are not defined by these data. The stems of individual ligands vary in sequence, length and structure (i.e., a variety of bulges and internal loops are allowed; Table 2). Qualitatively it is clear that the stems are validated by Watson/Crick covariation and that by the rules of comparative analysis the stems are not directly involved in binding WGA. Family 3 can form a similar hairpin in which 2 pairs of conserved nucleotides are utilized in the stem (FIG. 1 c ).

If it is not possible to fold the ligands of a sequence family into homologous structures, their assignment to a single family is questionable. Both ligand 11.7, the dominant member of family 4, and ligand 11.28 can be folded into two plane G-quartets. However, this assignment is speculative: 1) 11.28 contains five GG dinucleotides and one GGGG tetranucleotide allowing other G-quartets; and 2) ligands 11.2 and 11.33 cannot form G-quartets. On the other hand, all ligands can form a hairpin with the conserved sequence GAGRFTNCRT in the loop. However, the conserved sequence RCTGGC (Table 2) does not have a consistent role in these hairpins.

Multiple G-quartet structures are possible for Family 5. One of these resembles the ligand 11.7 G-quartet. No convincing hairpin structures are possible for ligand 11.20.

Example 7

2′-NH ₂RNA Ligands to Human L-Selectin

The experimental procedures outlined in this Example were used to identify and characterize the 2′-NH ₂RNA ligands to human L-selectin in Examples 8-12.

Experimental Procedures

A) Materials

LS-Rg is a chimeric protein in which the extracellular domain of human L-selectin is joined to the Fc domain of a human G2 immunoglobulin (Norgard et al., 1993, PNAS 90:1068-1072). ES-Rg, PS-Rg and CD22β-Rg are analogous constructs of E-selectin, P-selectin and CD22β joined to a human G1 immunoglobulin Fc domain (R. M. Nelson et al., 1993, supra; I. Stamenkovic et al., 1991, Cell 66, 1133-1144). Purified chimera were provided by A. Varki. Soluble P-selectin was purchased from R&D Systems. Protein A Sepharose 4 Fast Flow beads were purchased from Pharmacia Biotech. Anti-L-selectin monoclonal antibodies: SK11 was obtained from Becton-Dickinson, San Jose, Calif.; DREG-56, an L-selectin specific monoclonal antibody, was purchased from Endogen, Cambridge, Mass. The 2′-NH ₂modified CTP and UTP were prepared according to Pieken et. al. (1991, Science 253:314-317). DNA oligonucleotides were synthesized by Operon. All other reagents and chemicals were purchased from commercial sources. Unless otherwise indicated, experiments utilized HSMC buffer (1 mM CaCl ₂, 1 mM MgCl ₂, 150 mM NaCl, 20.0 mM HEPES, pH 7.4).

B) SELEX

The SELEX procedure is described in detail in U.S. Pat. No. 5,270,163 and elsewhere. The nucleotide sequence of the synthetic DNA template for the LS-Rg SELEX was randomized at 40 positions. This variable region was flanked by N7 5′ and 3′ fixed regions (40N7). 40N7 transcript has the sequence 5′ gggaggacgaugcgg40N-cagacgacucgcccga 3′ (SEQ ID NO: 64). All C and U have 2′-NH ₂substituted for 2′-OH on the ribose. The primers for the PCR were the following:

N7 5′ Primer 5′ taatacgactcactatagggaggacgatgcgg 3′ (SEQ ID NO: 65)

N7 3′ Primer 5′ tcgggcgagtcgtcctg 3′ (SEQ ID NO: 66)

The fixed regions include primer annealing sites for PCR and cDNA synthesis as well as a consensus T7 promoter to allow in vitro transcription. The initial RNA pool was made by first Klenow extending 1 nmol of synthetic single stranded DNA and then transcribing the resulting double stranded molecules with T7 RNA polymerase. Klenow extension conditions: 3.5 nmols primer 5N7, 1.4 nmols 40N7, 1× Klenow Buffer, 0.4 mM each of dATP, dCTP, dGTP and dTTP in a reaction volume of 1 ml.

For subsequent rounds, eluted RNA was the template for AMV reverse transcriptase mediated synthesis of single-stranded cDNA. These single-stranded DNA molecules were converted into double-stranded transcription templates by PCR amplification. PCR conditions were 50 mM KCl, 10 mM Tris-Cl, pH 8.3, 7.5 mM MgCl ₂, 1 mM of each dATP, dCTP, dGTP, and dTTP, and 25 U/ml of Taq DNA polymerase. Transcription reactions contained 0.5 mM DNA template, 200 nM T7 RNA polymerase, 80 mM HEPES (pH 8.0), 12 mM MgCl ₂, 5 mM DTT, 2 mM spermidine, 2 mM each of 2′-OH ATP, 2′-OH GTP, 2′-NH ₂CTP, 2′-NH ₂UTP, and 250 nM α- ³²P 2′-OH ATP.

The strategy for partitioning LS-Rg/RNA complexes from unbound RNA is outlined in Tables 7a and 7b. First, the RNA pool was incubated with LS-Rg immobilized on protein A sepharose beads in HSMC buffer. Second, the unbound RNA was removed by extensive washing. Third, the RNA molecules bound at the carbohydrate binding site were specifically eluted by incubating the washed beads in HMSC buffer containing 5 mM EDTA in place of divalent cations. The 5 mM elution was followed by a non-specific 50 mM EDTA elution. LS-Rg was coupled to protein A sepharose beads according to the manufacturer's instructions (Pharmacia Biotech).

The 5 mM EDTA elution is a variation of a specific site elution strategy. Although it is not a priori as specific as elution by carbohydrate competition, it is a general strategy for C-type (calcium dependent binding) lectins and is a practical alternative when the cost and/or concentration of the required carbohydrate competitor is unreasonable (as is the case with sialyl-Lewis ^x). This scheme is expected to be fairly specific for ligands that form bonds with the lectin's bound Ca ⁺⁺ because the low EDTA concentration does not appreciably increase the buffer's ionic strength and the conformation of C-type lectins is only subtly altered in the absence of bound calcium (unpublished observations cited by K. Drickamer, 1993, Biochem. Soc. Trans. 21:456-459).

In the initial SELEX rounds, which were performed at 4° C., the density of immobilized LS-Rg was 16.7 pmols/μl of Protein A Sepharose 4 Fast Flow beads. In later rounds, the density of LS-Rg was reduced (Tables 7a and 7b), as needed, to increase the stringency of selection. At the seventh round, the SELEX was branched and continued in parallel at 4° C. (Table 7a) and at room temperature (Table 7b). Wash and elution buffers were equilibrated to the relevant incubation temperature. Beginning with the fifth round, SELEX was often done at more than one LS-Rg density. In each branch, the eluted material from only one LS-Rg density was carried forward.

Before each round, RNA was batch adsorbed to 100 μl of protein A sepharose beads for 1 hour in a 2 ml siliconized column. Unbound RNA and RNA eluted with minimal washing (two volumes) were combined and used for SELEX input material. For SELEX, extensively washed, immobilized LS-Rg was batch incubated with pre-adsorbed RNA for 1 to 2 hours in a 2 ml siliconized column with constant rocking. Unbound RNA was removed by extensive batch washing (200 to 500 μl HSMC/wash). Bound RNA was eluted as two fractions; first, bound RNA was eluted by incubating and washing columns with 5 mM EDTA in HSMC without divalent cations; second, the remaining elutable RNA was removed by incubating and/or washing with 50 mM EDTA in HSMC without divalents. The percentage of input RNA that was eluted is recorded in Tables 7a and 7b. In every round, an equal volume of protein A sepharose beads without LS-Rg was treated identically to the SELEX beads to determine background binding. All unadsorbed, wash and eluted fractions were counted in a Beckman LS6500 scintillation counter in order to monitor each round of SELEX.

The eluted fractions were processed for use in the following round (Tables 7a and 7b). After extracting with phenol/chloroform and precipitating with isopropanol/ethanol (1:1, v/v), the RNA was reverse transcribed into cDNA by AMV reverse transcriptase either 1) at 48° C. for 15 minutes and then 65° C. for 15 minutes or 2) at 37° C. and 48° C. for 15 minutes each, in 50 mM Tris-Cl pH (8.3), 60 mM NaCl, 6 mM Mg(OAc) ₂, 10 mM DT7, 100 pmol DNA primer, 0.4 mM each of dNTPs, and 0.4 unit/μl AMV RT. Transcripts of the PCR product were used to initiate the next round of SELEX.

C) Nitrocellulose Filter Binding Assay

As described in SELEX Patent Applications, a nitrocellulose filter partitioning method was used to determine the affinity of RNA ligands for LS-Rg and for other proteins. Filter discs (nitrocellulose/cellulose acetate mixed matrix, 0.45 μm pore size, Millipore) were placed on a vacuum manifold and washed with 2 ml of HSMC buffer under vacuum. Reaction mixtures, containing ³²P labeled RNA pools and unlabeled LS-Rg, were incubated in HSMC for 10-20 min at 4° C., room temperature or 37° C., filtered, and then immediately washed with 4 ml HSMC at the same temperature. The filters were air-dried and counted in a Beckman LS6500 liquid scintillation counter without fluor.

LS-Rg is a dimeric protein that is the expression product of a recombinant gene constructed by fusing the DNA sequence that encodes the extracellular domains of human L-selectin to the DNA that encodes a human IgG ₂Fc region. For affinity calculations, we assume one RNA ligand binding site per LS-Rg monomer (two per dimer). The monomer concentration is defined as 2 times the LS-Rg dimer concentration. The equilibrium dissociation constant, K _d, for an RNA pool or specific ligand that binds monophasically is given by the equation
Kd=[Pf][Rf]/[RP]

- where, [Rf]=free RNA concentration
  - [Pf]=free LS-Rg monomer concentration
  - [RP]=concentration of RNA/LS-Rg complexes
  - K _d=dissociation constant
    A rearrangement of this equation, in which the fraction of RNA bound at equilibrium is expressed as a function of the total concentration of the reactants, was used to calculate Kds of monophasic binding curves:
    q =( P _T +R _T +K _d−(( P _T +R _T +K _d) ²−4 P _T R _T) ^1/2)
- q=fraction of RNA bound
- [P _T]=2×(total LS-Rg concentration)
- [R _T]=total RNA concentration
  Many ligands and evolved RNA pools yield biphasic binding curves. Biphasic binding can be described as the binding of two affinity species that are not in equilibrium. Biphasic binding data were evaluated with the equation
  q= 2 P _t +R _t +Kd ₁ +Kd ₂−[( P _t +X ₁ R ₁ +K _d1) ²−4 P _t X ₁ R _t] ^1/2−[( P _t +X ₂ R _t +K _d2) ²−4 P _t X ₂ R _t] ^1/2,
  where X ₁and X ₂are the mole fractions of affinity species R ₁and R ₂and K _d1and K _d2are the corresponding dissociation constants. K _ds were determined by least square fitting K _ds were determined by least square fitting of the data points using the graphics program Kaleidagraph (Synergy Software, Reading, Pa.).
  D) Cloning and Sequencing

Sixth, thirteenth (RT) and fourteenth (4° C.) round PCR products were re-amplified with primers which contain either a BanHI or a HinDIII restriction endonuclease recognition site. Using these restriction sites, the DNA sequences were inserted directionally into the pUC9 vector. These recombinant plasmids were transformed into E. coli strain DH5a (Life Technologies, Gaithersburg, Md.). Plasmid DNA was prepared according to the alkaline hydrolysis method (PERFECTprep, 5′-3′, Boulder, Colo.). Approximately 150 clones were sequenced using the Sequenase protocol (Amersham, Arlington Heights, Ill.). The resulting ligand sequences are shown in Table 8.

E) Cell Binding Studies

The ability of evolved ligand pools and cloned ligands to bind to L-selectin presented in the context of a cell surface was tested in experiments with isolated human peripheral blood mononuclear cells (PBMCs). Whole blood, collected from normal volunteers, was anticoagulated with 5 mM EDTA. Six milliliters of blood were layered on a 6 ml Histopaque gradient in 15 ml polypropylene tube and centrifuged (700 g) at room temperature for 30 minutes. The mononuclear cell layer was collected, diluted in 10 ml of Ca ⁺⁺/Mg ⁺⁺-free DPBS (DPBS(−); Gibco 14190-029) and centrifuged (225 g) for 10 minutes at room temperature. Cell pellets from two gradients were combined, resuspended in 10 ml of DPBS(−) and recentrifuged as described above. These pellets were resuspended in 100 μl of SMHCK buffer supplemented with 1% BSA. Cells were counted in a hemocytometer, diluted to 2×10 ⁷cells/ml in SMHCK/1% BSA and immediately added to binding assays. Cell viability was monitored by trypan blue exclusion.

For cell binding assays, a constant number of cells were titrated with increasing concentrations of radiolabeled ligand. The test ligands were serially diluted in DPBS(−)/1% BSA to 2-times the desired final concentration approximately 10 minutes before use. Equal volumes (25 μl) of each ligand dilution and the cell suspension (2×10 ⁷cells/ml) were added to 0.65 ml eppendorf tubes, gently vortexed and incubated on ice for 30 minutes. At 15 minutes the tubes were revortexed. The ligand/PBMC suspension was layered over 50 μl of ice cold phthalate oil (1:1=dinonyl:dibutyl phthalate) and microfuged (14,000 g) for 5 minutes at 4° C. Tubes were frozen in dry ice/ethanol, visible pellets amputated into scintillation vials and counted in Beckman LS6500 scintilation counter as described in Example 7, paragraph C.

The specificity of binding to PBMCs was tested by competition with the L-selectin specific blocking monoclonal antibody, DREG-56, while saturability of binding was tested by competition with unlabeled RNA. Experimental procedure and conditions were like those for PBMC binding experiments, except that the radiolabeled RNA ligand (final concentration 5 nM) was added to serial dilutions of the competitor before mixing with PBMCs.

F) Inhibition of Selectin Binding to Sialyl-Lewis ^x

The ability of evolved RNA pools or cloned ligands to inhibit the binding of LS-Rg to sialyl-Lewis ^xwas tested in competive ELISA assays (C. Foxall et al., 1992, supra). For these assays, the wells of Corning (25801) 96 well microtiter plates were coated with 100 ng of a sialyl-Lewis ^x/BSA conjugate, air drie

5270163	Methods for identifying nucleic acid ligands	December, 1993	Gold et al.
5304640	DNA sequence encoding a selectin ligand	April, 1994	Lasky et al.	536/23.5
5459015	High-affinity RNA ligands of basic fibroblast growth factor	October, 1995	Janjic et al.
5472841	Methods for identifying nucleic acid ligands of human neutrophil elastase	December, 1995	Jayasena et al.
5475096	Nucleic acid ligands	December, 1995	Gold et al.
5476766	Ligands of thrombin	December, 1995	Gold et al.
5484891	Selectin ligands	January, 1996	Lasky et al.
5489677	Oligonucleoside linkages containing adjacent oxygen and nitrogen atoms	February, 1996	Sanghvi et al.
5496938	Nucleic acid ligands to HIV-RT and HIV-1 rev	March, 1996	Gold et al.
5503978	Method for identification of high affinity DNA ligands of HIV-1 reverse transcriptase	April, 1996	Schneider et al.
5527894	Ligands of HIV-1 tat protein	June, 1996	Gold et al.
5543293	DNA ligands of thrombin	August, 1996	Gold et al.
5567588	Systematic evolution of ligands by exponential enrichment: Solution SELEX	October, 1996	Gold et al.
5580737	High-affinity nucleic acid ligands that discriminate between theophylline and caffeine	December, 1996	Polisky et al.
5587468	High affinity nucleic acid ligands to HIV integrase	December, 1996	Allen et al.
5595877	Methods of producing nucleic acid ligands	January, 1997	Gold et al.
5723323	Method of identifying a stochastically-generated peptide, polypeptide, or protein having ligand binding property and compositions thereof	March, 1998	Kauffman et al.
5780228	High affinity nucleic acid ligands to lectins	July, 1998	Parma et al.
5800815	Antibodies to P-selectin and their uses	September, 1998	Chestnut et al.	424/153.1
6001988	High affinity nucleic acid ligands to lectins	December, 1999	Parma et al.

GB2183661	June, 1987
WO/1989/006694	July, 1989	PROCESS FOR SELECTION OF PROTEINACEOUS SUBSTANCES WHICH MIMIC GROWTH-INDUCING MOLECULES
WO/1991/019813	December, 1991	NUCLEIC ACID LIGANDS
WO/1992/014843	September, 1992	APTAMER SPECIFIC FOR BIOMOLECULES AND METHOD OF MAKING
WO/1994/009158	April, 1994	METHOD FOR SELECTING NUCLEIC ACIDS ON THE BASIS OF STRUCTURE
WO/1996/034876	November, 1996	NUCLEIC ACID LIGAND COMPLEXES

RELATEDNESS OF THE APPLICATION

FIELD OF THE INVENTION

BACKGROUND OF THE INVENTION

BRIEF SUMMARY OF THE INVENTION

BRIEF DESCRIPTION OF THE FIGURES

DETAILED DESCRIPTION OF THE INVENTION

EXAMPLES

Example 1

Nucleic Acid Ligands to Wheat Germ Agglutinin

Experimental Procedures

Example 2

RNA Ligands to WGA

Example 3

Specificity of RNA Ligands to WGA

Example 4

Competitive Binding Studies

Example 5

Inhibition of WGA Agglutinating Activity

Example 6

Secondary Structure of High Affinity WGA Ligands

Example 7

2′-NH 2 RNA Ligands to Human L-Selectin

Experimental Procedures

2′-NH ₂RNA Ligands to Human L-Selectin