Krieg, Arthur M. (Wellesley, MA, US)
Kline, Joel N. (Iowa City, IA, US)

Plaque It! Sponsored by: Flash of Genius

10/831647

07/22/2008

04/23/2004

Images are available in PDF form when logged in. To view PDFs, Login  or  Create Account (Free!)

View patents that cite this patent

Click for automatic bibliography generation

University of Iowa Research Foundation (Iowa City, IA, US)

536/23.1

424/278.1, 514/44

A01N43/04; A61K31/70; A61K45/00; A61K47/00; C07H21/02; C07H21/04

536/23.1, 424/278.1, 514/44

5112605	Temporal gamma-interferon administration for allergies	May, 1992	Jardieu et al.
5498410	Method for the treatment of eosinophil-associated conditions with anionic polymers	March, 1996	Gleich
5663153	Immune stimulation by phosphorothioate oligonucleotide analogs	September, 1997	Hutcherson et al.
5679647	Methods and devices for immunizing a host against tumor-associated antigens through administration of naked polynucleotides which encode tumor-associated antigenic peptides	October, 1997	Carson et al.
5681555	Method for the treatment of bronchial asthma by parenteral administration of anionic polymers	October, 1997	Gleich
5723335	Immune stimulation by phosphorothioate oligonucleotide analogs	March, 1998	Hutcherson et al.
5726160	Methods for treating respiratory disease	March, 1998	McMichael
5804566	Methods and devices for immunizing a host through administration of naked polynucleotides with encode allergenic peptides	September, 1998	Carson et al.
5849719	Method for treating allergic lung disease	December, 1998	Carson et al.
5908620	Treatment for diseases involving inflammation	June, 1999	Tu et al.
5955059	Use of locally applied DNA fragments	September, 1999	Gilchrest et al.
5955442	Methods for treating respiratory disease	September, 1999	McMichael
5994315	Low adenosine agent, composition, kit and method for treatment of airway disease	November, 1999	Nyce et al.
6025339	Composition, kit and method for treatment of disorders associated with bronchoconstriction and lung inflammation	February, 2000	Nyce et al.
6040296	Specific antisense oligonucleotide composition & method for treatment of disorders associated with bronchoconstriction and lung inflammation	March, 2000	Nyce et al.
6086898	Method of converting a Th2-type allergic immune response into a Th1-type immune response	July, 2000	DeKruyff et al.
6096721	Method for treating mucositis by sublingual administration of DNA	August, 2000	McMichael
6100244	Method for treating respiratory distress by sublingual administration of DNA	August, 2000	McMichael
6174872	Method for treating allergic lung disease	January, 2001	Carson et al.
6194388	Immunomodulatory oligonucleotides	February, 2001	Krieg et al.
6207646	Immunostimulatory nucleic acid molecules	March, 2001	Krieg et al.
6214806	Use of nucleic acids containing unmethylated CPC dinucleotide in the treatment of LPS-associated disorders	April, 2001	Krieg et al.
6218371	Methods and products for stimulating the immune system using immunotherapeutic oligonucleotides and cytokines	April, 2001	Krieg et al.
6221882	Methods for inhibiting immunostimulatory DNA associated responses	April, 2001	Macfarlane
6239116	Immunostimulatory nucleic acid molecules	May, 2001	Krieg et al.
6339068	Vectors and methods for immunization or therapeutic protocols	January, 2002	Krieg et al.
6399630	Methods for inhibiting immunostimulatory DNA associated responses	June, 2002	Macfarlane
6406705	Use of nucleic acids containing unmethylated CpG dinucleotide as an adjuvant	June, 2002	Davis et al.
6426336	Method for treating allergic lung disease	July, 2002	Carson et al.
6429199	Immunostimulatory nucleic acid molecules for activating dendritic cells	August, 2002	Krieg et al.
6479504	Antagonism of immunostimulatory CpG-oligonucleotides by 4-aminoquinolines and other weak bases	November, 2002	Macfarlane et al.
6498148	Immunization-free methods for treating antigen-stimulated inflammation in a mammalian host and shifting the host's antigen immune responsiveness to a Th1 phenotype	December, 2002	Raz
6514948	Method for enhancing an immune response	February, 2003	Raz et al.
6521637	Methods for inhibiting immunostimulatory DNA associated responses	February, 2003	Macfarlane
6552006	Immunomodulatory polynucleotides in treatment of an infection by an intracellular pathogen	April, 2003	Raz et al.
6558670	Vaccine adjuvants	May, 2003	Friede et al.
6562798	Immunostimulatory oligonucleotides with modified bases and methods of use thereof	May, 2003	Schwartz
6589940	Immunostimulatory oligonucleotides, compositions thereof and methods of use thereof	July, 2003	Raz et al.
6610661	Immunostimulatory polynucleotide/immunomodulatory molecule conjugates	August, 2003	Carson et al.
6653292	Method of treating cancer using immunostimulatory oligonucleotides	November, 2003	Krieg et al.
6727230	Immune stimulation by phosphorothioate oligonucleotide analogs	April, 2004	Hutcherson et al.
6821957	Vectors and methods for immunization or therapeutic protocols	November, 2004	Krieg et al.
6835395	Composition containing small multilamellar oligodeoxynucleotide-containing lipid vesicles	December, 2004	Semple et al.
6943240	Nucleic acids for high throughput screening of CpG-based immuno-agonist/antagonist	September, 2005	Bauer et al.
6949520	Methods related to immunostimulatory nucleic acid-induced interferon	September, 2005	Hartmann et al.
6951845	Method for treating allergic lung disease	October, 2005	Carson et al.
7001890	Pharmaceutical compositions comprising a polynucleotide and optionally an antigen especially for vaccination	February, 2006	Wagner et al.
7223741	Immunostimulatory nucleic acid molecules	May, 2007	Krieg	514/44
7271156	Immunostimulatory nucleic acids	September, 2007	Krieg et al.	514/44
20010044416	Immunostimulatory nucleic acids for inducing a Th2 immune response	November, 2001	McCluskie et al.
20010046967	Methods of preventing and treating respiratory viral infection using immunomodulatory polynucleotide	November, 2001	Van Nest et al.
20020028784	Methods of preventing and treating viral infections using immunomodulatory polynucleotide sequences	March, 2002	Van Nest et al.
20020086839	Inhibitors of DNA immunostimulatory sequence activity	July, 2002	Raz et al.
20020091097	Nucleic acids for the prevention and treatment of sexually transmitted diseases	July, 2002	Bratzler et al.
20020098199	Methods of suppressing hepatitis virus infection using immunomodulatory polynucleotide sequences	July, 2002	Van Nest et al.
20020102255	CpG oligonucleotides and related compounds for enhancing ADCC induced by anti-IgE antibodies	August, 2002	Chang
20020107212	Methods of reducing papillomavirus infection using immunomodulatory polynucleotide sequences	August, 2002	Van Nest et al.
20020156033	Immunostimulatory nucleic acids and cancer medicament combination therapy for the treatment of cancer	October, 2002	Bratzler et al.
20020164341	Use of nucleic acids containing unmethylated CpG dinucleotide as an adjuvant	November, 2002	Davis et al.
20020165178	Immunostimulatory nucleic acids for the treatment of anemia, thrombocytopenia, and neutropenia	November, 2002	Schetter et al.
20020198165	Nucleic acids for the prevention and treatment of gastric ulcers	December, 2002	Bratzler et al.
20030026782	IMMUNOMODULATORY OLIGONUCLEOTIDES	February, 2003	Krieg
20030026801	Methods for enhancing antibody-induced cell lysis and treating cancer	February, 2003	Weiner et al.
20030027782	Method for treating allergic lung disease	February, 2003	Carson et al.
20030049266	Immunomodulatory polynucleotides and methods of using the same	March, 2003	Fearon et al.
20030050261	Immunostimulatory nucleic acid molecules	March, 2003	Krieg et al.
20030050263	Methods and products for treating HIV infection	March, 2003	Krieg et al.
20030050268	Immunostimulatory nucleic acid for treatment of non-allergic inflammatory diseases	March, 2003	Krieg et al.
20030055014	Inhibition of angiogenesis by nucleic acids	March, 2003	Bratzler
20030064064	Methods of treating IgE-associated disorders and compositions for use therein	April, 2003	Dina et al.
20030078223	Compositions and methods for modulating an immune response	April, 2003	Raz et al.
20030091599	Use of nucleic acids containing unmethylated CpG dinucleotide as an adjuvant	May, 2003	Davis et al.
20030092663	Immunization-free methods for treating antigen-stimulated inflammation in a mammalian host and shifting the host's antigen immune responsiveness to a Th1 phenotype	May, 2003	Raz et al.
20030100527	Immunostimulatory nucleic acid molecules for activating dendritic cells	May, 2003	Krieg et al.
20030119773	Method for enhancing an immune response	June, 2003	Raz et al.
20030139364	Methods and products for enhancing immune responses using imidazoquinoline compounds	July, 2003	Krieg et al.
20030148316	Methods and compositions relating to plasmacytoid dendritic cells	August, 2003	Lipford et al.
20030148976	Combination motif immune stimulatory oligonucleotides with improved activity	August, 2003	Krieg et al.
20030166001	Toll-like receptor 3 signaling agonists and antagonists	September, 2003	Lipford
20030181406	CpG-like nucleic acids and methods of use thereof	September, 2003	Schetter et al.
20030191079	Methods for treating and preventing infectious disease	October, 2003	Krieg et al.
20030212026	Immunostimulatory nucleic acids	November, 2003	Krieg et al.
20030212028	Immunomodulatory polynucleotides in treatment of an infection by an intracellular pathogen	November, 2003	Raz et al.
20030216340	Methods of suppressing hepatitis virus infection using immunomodulatory polynucleotide sequences	November, 2003	Van Nest et al.
20030224010	Use of nucleic acids containing unmethylated CpG dinucleotide as an adjuvant	December, 2003	Davis et al.
20030232074	Immunostimulatory G, U-containing oligoribonucleotides	December, 2003	Lipford et al.
20030232780	Immunostimulatory polynucleotide/immunomodulatory molecule conjugates	December, 2003	Carson et al.
20030232856	Methods for inhibiting immunostimulatory DNA associated responses	December, 2003	Macfarlane
20040006010	Immunostimulatory polynucleotide/immunomodulatory molecule conjugates	January, 2004	Carson et al.
20040006034	Immunostimulatory oligonucleotides, compositions thereof and methods of use thereof	January, 2004	Raz et al.
20040009942	Methods of preventing and treating respiratory viral infection using immunomodulatory polynucleotide sequences	January, 2004	Van Nest et al.
20040009949	Method for treating autoimmune or inflammatory diseases with combinations of inhibitory oligonucleotides and small molecule antagonists of immunostimulatory CpG nucleic acids	January, 2004	Krieg
20040030118	Methods for regulating hematopoiesis using CpG-oligonucleotides	February, 2004	Wagner et al.
20040053880	Nucleic acid compositions for stimulating immune responses	March, 2004	Krieg
20040064064	Method and system for detecting the effects of alzheimer's disease in the human retina	April, 2004	Zhou et al.
20040067902	Immunostimulatory nucleic acids for the treatment of asthma and allergy	April, 2004	Bratzler et al.
20040067905	Nucleic acid compositions for stimulating immune responses	April, 2004	Krieg
20040087534	Immunomodulatory oligonucleotides	May, 2004	Krieg et al.
20040087538	Methods of treating cancer using immunostimulatory oligonucleotides	May, 2004	Krieg et al.
20040092468	Immunostimulatory oligonucleotides with modified bases and methods of use thereof	May, 2004	Schwartz et al.
20040092472	Nucleic acid compositions for stimulating immune responses	May, 2004	Krieg
20040106568	Methods for treating and preventing infectious disease	June, 2004	Krieg et al.
20040131628	Nucleic acids for the treatment of disorders associated with microorganisms	July, 2004	Bratzler et al.
20040132685	Immunostimulatory nucleic acid	July, 2004	Krieg et al.
20040142469	Immunomodulatory oligonucleotides	July, 2004	Krieg et al.
20040143112	Immunomodulatory oligonucleotides	July, 2004	Krieg et al.
20040147468	Immunostimulatory nucleic acid molecules	July, 2004	Krieg et al.
20040152649	Nucleic acid compositions for stimulating immune responses	August, 2004	Krieg
20040152656	Immunomodulatory oligonucleotides	August, 2004	Krieg et al.
20040152657	Immunomodulatory oligonucleotides	August, 2004	Krieg et al.
20040162258	Immunomodulatory oligonucleotides	August, 2004	Krieg et al.
20040162262	Immunomodulatory oligonucleotides	August, 2004	Krieg et al.
20040167089	Immunostimulatory nucleic acid molecules	August, 2004	Krieg et al.
20040171150	Immunomodulatory oligonucleotides	September, 2004	Krieg et al.
20040171571	5' CpG nucleic acids and methods of use	September, 2004	Krieg et al.
20040181045	Immunomodulatory oligonucleotides	September, 2004	Krieg et al.
20040198680	Nucleic acid compositions for stimulating immune responses	October, 2004	Krieg
20040198688	Immunostimulatory nucleic acid molecules	October, 2004	Krieg et al.
20040229835	Immunostimulatory nucleic acid molecules	November, 2004	Krieg et al.
20040234512	Methods for regualting hematopoiesis using CpG-oligonucleotides	November, 2004	Wagner et al.
20040235770	Immunostimulatory nucleic acid oil-in-water formulations and related methods of use	November, 2004	Davis et al.
20040235774	Immunostimulatory nucleic acids for the treatment of asthma and allergy	November, 2004	Bratzler et al.
20040235777	Methods for regulating hematopoiesis using CpG-oligonucleotides	November, 2004	Wagner et al.
20040235778	Methods for regulating hematopoiesis using CpG-oligonucleotides	November, 2004	Wagner et al.
20040247662	Systemic immune activation method using nucleic acid-lipid complexes	December, 2004	Dow et al.
20040248837	Methods of treating pulmonary fibrotic disorders	December, 2004	Raz et al.
20040266719	Methods and products for inducing mucosal immunity	December, 2004	McCluskie et al.
20050004061	Immunostimulatory nucleic acid molecules	January, 2005	Krieg et al.
20050004062	Immunomodulatory oligonucleotides	January, 2005	Krieg et al.
20050009774	Immunomodulatory oligonucleotides	January, 2005	Krieg et al.
20050013812	Vaccines using pattern recognition receptor-ligand:lipid complexes	January, 2005	Dow et al.
20050032734	Vectors and methods for immunization or therapeutic protocols	February, 2005	Davis et al.
20050032736	Immunostimulatory nucleic acid molecules	February, 2005	Krieg et al.
20050037403	Immunomodulatory oligonucleotides	February, 2005	Krieg et al.
20050037985	Methods and products for treating HIV infection	February, 2005	Krieg et al.
20050043529	Use of nucleic acids containing unmethylated CpG dinucleotide as an adjuvant	February, 2005	Davis et al.
20050049215	Immunostimulatory nucleic acid molecules	March, 2005	Krieg et al.
20050049216	Immunostimulatory nucleic acid molecules	March, 2005	Krieg et al.
20050054601	Pharmaceutical composition comprising a polynucleotide and optionally an antigen especially for vaccination	March, 2005	Wagner et al.
20050054602	Immunostimulatory nucleic acid molecules	March, 2005	Krieg et al.
20050059619	Immunostimulatory nucleic acids	March, 2005	Krieg et al.
20050059625	Immunostimulatory nucleic acid molecules	March, 2005	Krieg et al.
20050070491	Immunostimulatory nucleic acid molecules	March, 2005	Krieg et al.
20050075302	Immune stimulation by phosphorothioate oligonucleotide analogs	April, 2005	Hutcherson et al.
20050100983	Cell-free methods for identifying compounds that affect toll-like receptor 9 (TLR9) signaling	May, 2005	Bauer et al.
20050101554	Methods for treating and preventing infectious disease	May, 2005	Krieg et al.
20050101557	Immunostimulatory nucleic acid molecules	May, 2005	Krieg et al.
20050119273	Small molecule toll-like receptor (TLR) antagonists	June, 2005	Lipford et al.
20050123523	Immunostimulatory nucleic acid molecules	June, 2005	Krieg et al.
20050130911	Nucleic acid-lipophilic conjugates	June, 2005	Uhlmann et al.
20050148537	Immunostimulatory nucleic acid molecules	July, 2005	Krieg et al.
20050169888	Methods related to immunostimulatory nucleic acid-induced interferon	August, 2005	Hartman et al.
20050171047	Immunostimulatory nucleic acid molecules	August, 2005	Krieg et al.
20050181422	Process for high throughput screening of CpG-based immuno-agonist/antagonist	August, 2005	Bauer et al.
20050182017	Immunostimulatory nucleic acid molecules	August, 2005	Krieg
20050197314	Methods and products for stimulating the immune system using immunotherapeutic oligonucleotides and cytokines	September, 2005	Krieg et al.
20050215500	Immunostimulatory nucleic acid molecules	September, 2005	Krieg et al.
20050215501	Methods and products for enhancing epitope spreading	September, 2005	Lipford et al.
20050233995	Immunostimulatory nucleic acid molecules	October, 2005	Krieg et al.
20050233999	Immunostimulatory nucleic acid molecules	October, 2005	Krieg et al.
20050239732	Immunostimulatory nucleic acid molecules	October, 2005	Krieg et al.
20050239733	Sequence requirements for inhibitory oligonucleotides	October, 2005	Jurk et al.
20050239734	C-class oligonucleotide analogs with enhanced immunostimulatory potency	October, 2005	Uhlmann et al.
20050239736	Immunomodulatory oligonucleotides	October, 2005	Krieg et al.
20050244379	Immunomodulatory oligonucleotides	November, 2005	Krieg et al.
20050244380	Immunomodulatory oligonucleotides	November, 2005	Krieg et al.
20050245477	Immunomodulatory oligonucleotides	November, 2005	Krieg et al.
20050250726	Immunostimulatory nucleic acid for treatment of non-allergic inflammatory diseases	November, 2005	Krieg et al.
20050256073	Immunostimulatory viral RNA oligonucleotides	November, 2005	Lipford et al.
20050267064	Immunostimulatory nucleic acid molecules	December, 2005	Krieg et al.
20050277604	Immunostimulatory nucleic acid molecules	December, 2005	Krieg et al.
20050277609	Immunostimulatory nucleic acid molecules	December, 2005	Krieg et al.
20060003955	Immunostimulatory nucleic acid molecules	January, 2006	Krieg et al.
20060003962	Methods and products related to treatment and prevention of hepatitis C virus infection	January, 2006	Ahluwalia et al.
20060019916	Immunostimulatory nucleic acids for inducing IL-10 responses	January, 2006	Krieg et al.
20060019923	Methods and compositions for inducing innate immune responses	January, 2006	Davis et al.
20060058251	Methods for treating and preventing infectious disease	March, 2006	Krieg et al.
20060089326	Immunostimulatory nucleic acid molecules	April, 2006	Krieg et al.
20060094683	Immunomodulatory oligonucleotides	May, 2006	Krieg et al.
20060140875	Semi-soft C-class immunostimulatory oligonucleotides	June, 2006	Krieg et al.
20060154890	Immunostimulatory nucleic acids for the treatment of asthma and allergy	July, 2006	Bratzler et al.
20060172966	Immunostimulatory G, U-containing oligoribonucleotides	August, 2006	Lipford et al.
20060188913	Methods and products for enhancing immune responses using imidazoquinoline compounds	August, 2006	Krieg et al.
20060211639	Immunostimulatory nucleic acids and cancer medicament combination therapy for the treatment of cancer	September, 2006	Bratzler et al.
20060211644	Immunostimulatory oligonucleotides	September, 2006	Krieg et al.
20060229271	Methods for treating infectious disease exacerbated asthma	October, 2006	Krieg et al.
20060241076	Modified oligoribonucleotide analogs with enhanced immunostimulatory activity	October, 2006	Uhlmann et al.
20060246035	Methods and products related to treatment and prevention of hepatitis c virus infection	November, 2006	Ahluwalia et al.
20060286070	Methods related to immunostimulatory nucleic acid-induced interferon	December, 2006	Hartmann et al.
20060287263	Methods and compositions for inducing antigen-specific immune responses	December, 2006	Davis et al.
20070009482	Immunomodulatory oligonucleotides	January, 2007	Krieg et al.
20070010470	Immunomodulatory oligonucleotides	January, 2007	Krieg et al.
20070037767	Immunostimulatory nucleic acids for the treatment of asthma and allergy	February, 2007	Bratzler et al.
20070065467	Immunostimulatory nucleic acid molecules for activating dendritic cells	March, 2007	Krieg et al.	424/275.1
20070066553	Immunostimulatory nucleic acid molecules	March, 2007	Krieg et al.	514/44
20070066554	Immunostimulatory nucleic acids	March, 2007	Krieg et al.
20070078104	Immunostimulatory nucleic acid molecules	April, 2007	Krieg et al.
20070129320	Methods and compositions for inducing innate immune responses	June, 2007	Davis et al.
20070142315	Immunostimulatory oligoribonucleotides	June, 2007	Forsbach et al.
20070184465	Methods for regulating hematopoiesis using CpG-oligonucleotides	August, 2007	Wagner et al.
20070202128	Immunomodulatory oligonucleotides	August, 2007	Krieg et al.
20070224210	Immunostimulatory nucleic acids	September, 2007	Krieg et al.	424/185.1
20070270337	Pharmaceutical Compositions for Preventing or Treating Th1-Mediated Immune Diseases	November, 2007	Hori	514/12
20080009455	Immunostimulatory oligonucleotides	January, 2008	Krieg et al.	514/44
20080026011	Immunostimulatory nucleic acid molecules	January, 2008	Krieg et al.	424/275.1
20080031936	Immunostimulatory nucleic acid molecules	February, 2008	Krieg et al.	424/450
20080045473	Compositions and methods for oligonucleotide formulations	February, 2008	Uhlmann et al.	514/44

EP0468520	January, 1992			IM
WO/1996/032138	October, 1996			METHODS FOR TREATING RESPIRATORY DISEASE
WO/1996/040162	December, 1996			METHOD OF TREATMENT FOR LUNG DISEASES USING ANTISENSE OLIGONUCLEOTIDES
WO/1997/028259	August, 1997			GENE EXPRESSION VECTORS WHICH GENERATE AN ANTIGEN SPECIFIC IMMUNE RESPONSE AND METHODS OF USING THE SAME
WO/1997/030731	August, 1997			METHOD OF PREPARING POLYNUCLEOTIDE-CARRIER COMPLEXES FOR DELIVERY TO CELLS
WO/1999/056755	November, 1999			METHODS FOR THE PREVENTION AND TREATMENT OF PARASITIC INFECTIONS AND RELATED DISEASES USING CPG OLIGONUCLEOTIDES
WO/2000/006588	February, 2000			STEREOISOMERS OF CpG OLIGONUCLEOTIDES AND RELATED METHODS
WO/2000/014217	March, 2000			G-MOTIF OLIGONUCLEOTIDES AND USES THEREOF
WO/2000/054803	September, 2000			IMMUNOSTIMULATORY NUCLEIC ACIDS AND ANTIGENS
WO/2000/067023	November, 2000			SCREENING FOR IMMUNOSTIMULATORY DNA FUNCTIONAL MODIFYERS
WO/2001/012223	February, 2001			METHODS OF MODULATING AN IMMUNE RESPONSE USING IMMUNOSTIMULATORY SEQUENCES AND COMPOSITIONS FOR USE THEREIN
WO/2004/007743	January, 2004			USE OF CPG NUCLEIC ACIDS IN PRION-DISEASE
WO/2004/026888	April, 2004			TOLL-LIKE RECEPTOR 9 (TLR9) FROM VARIOUS MAMMALIAN SPECIES
WO/2004/094671	November, 2004			METHODS AND PRODUCTS FOR IDENTIFICATION AND ASSESSMENT OF TLR LIGANDS
WO/2006/080946	August, 2006			ABASIC OLIGONUCLEOTIDE AS CARRIER PLATFORM FOR ANTIGEN AND IMMUNOSTIMULATORY AGONIST AND ANTAGONIST
WO/2007/031877	March, 2007			MODULATION OF IMMUNOSTIMULATORY PROPERTIES OF SHORT INTERFERING RIBONUCLEIC ACID (SIRNA) BY NUCLEOTIDE MODIFICATION
WO/2007/038720	April, 2007			MODULATION OF TLR-MEDIATED IMMUNE RESPONSES USING ADAPTOR OLIGONUCLEOTIDES

Van Uden et al, J. Allergy Clin. Immunol., 1999, 104:902-910.
Krieg, Vaccine, 2001, 19:618-622.
Hussain et al, Current Drug Targets—Inflammation & Allergy, 20033, 2:199-205.
Jain et al, Clin. Exp. Allergy, 2003, 33:1330-1335.
Kitagaki et al, Clinical and Experimental Immunology, 2005, 143:249-259.
Weiss et al, Current Drug Targets—Inflammation & Allergy, 2005, 4:585-597.
Leonard et al, Biodrugs, 2203, 17:1-7.
Kitagaki et al, In: Microbial DNA and Host Immunity, 2002, editor E. Raz, pp. 301-314.
Horner et al, J. Allergy Clin. Immunol., 2002, 2:413-420.
Peng et al, International Immunology, Jan. 2001, 13/1:3-11.
Heeg et al, Int. Arch. Allergy Immunol., 2000, 121:87-97.
Tournoy et al, Clin. Exp. Allergy, 2002, 31:17-29.
[No Author Listed] National Institute of Health, Publication No. 97-4051, Jul. 1997.
Press Release, Jan. 2007, “Coley Pharmaceutical Group Updates Hepatitis C Drug Development Strategy”.
Press Release, Jun. 2007, “Coley Pharmaceutical Group Announces Pfizer's Discontinuation of Clinical Trials for PF-3512676 Combined with Cytotoxic Chemotherapy in Advanced Non Small Cell Lung Cancer”.
Agrawal et al., Chapter 19: Pharmacokinetics and bioavailability of antisense oligonucleotides following oral and colorectal administrations in experimental animals. 1998: 525-43.
Anderson et al., TH2 and ‘TH2-like’ cells in allergy and asthma: pharmacological perspectives. Trends Pharmacol Sci. Sep. 1994;15(9):324-32.
Anitescu et al., Interleukin-10 functions in vitro and in vivo to inhibit bacterial DNA-induced secretion of interleukin-12. J Interferon Cytokine Res. Dec. 1997;17(12):781-8.
Ballas et al., Induction of NK activity in murine and human cells by CpG motifs in oligodeoxynucleotides and bacterial DNA. J Immunol. Sep. 1, 1996;157(5):1840-5.
Boggs et al., Characterization and modulation of immune stimulation by modified oligonucleotides. Antisense Nucleic Acid Drug Dev. Oct. 1997;7(5):461-71.
Brazolot Millan et al., CpG DNA can induce strong Th1 humoral and cell-mediated immune responses against hepatitis B surface antigen in young mice. Proc Natl Acad Sci U S A. Dec. 22, 1998;95(26):15553-8.
Broide et al., DNA-Based immunuzation for asthma. Int Arch Allergy Immunol. Feb.-Apr. 1999;118(2-4):453-6.
Broide et al., Immunostimulatory DNA sequences inhibit IL-5, eosinophilic inflammation, and airway hyperresponsiveness in mice. J Immunol. Dec. 15, 1998;161(12):7054-62.
Broide et al., Modulation of asthmatic response by immunostimulatory DNA sequences. Springer Semin Immunopathol. 2000;22(1-2):117-24.
Carson et al., Oligonucleotide adjuvants for T helper 1 (Th1)-specific vaccination. J Exp Med. Nov. 17, 1997;186(10):1621-2.
Chace et al., Bacterial DNA-induced NK cell IFN-gamma production is dependent on macrophage secretion of IL-12. Clin Immunol Immunopathol. Aug. 1997;84(2):185-93.
Chu et al., CpG oligodeoxynucleotides act as adjuvants that switch on T helper 1 (Th1) immunity. J Exp Med. Nov. 17, 1997;186(10):1623-31.
Cowdery et al., Bacterial DNA induces NK cells to produce IFN-gamma in vivo and increases the toxicity of lipopolysaccharides. J Immunol. Jun. 15, 1996;156(12):4570-5.
Durham et al., Immunotherapy and allergic inflammation. Clin Exp Allergy. Jan. 1991;21 Suppl 1:206-10.
Fornadley, Allergy immunotherapy. Otolaryngol Clin North Am. Feb. 1998;31(1):111-27. Abstract Only.
Halpern et al., Bacterial DNA induces murine interferon-gamma production by stimulation of interleukin-12 and tumor necrosis factor-alpha. Cell Immunol. Jan. 10, 1996;167(1):72-8.
Hogg, The pathology of asthma. APMIS. Oct. 1997;105(10):735-45.
Horner et al., Immunostimulatory sequence oligodeoxynucleotide-based vaccination and immunomodulation: two unique but complementary strategies for the treatment of allergic diseases. J Allergy Clin Immunol. Nov. 2002;110(5):706-12.
Hussain et al., CpG oligodeoxynucleotides: a novel therapeutic approach for atopic disorders. Curr Drug Targets Inflamm Allergy. Sep. 2003;2(3):199-205.
Jain et al., CpG DNA and immunotherapy of allergic airway diseases. Clin Exp Allergy. Oct. 2003;33(10):1330-5.
Jakob et al., Activation of cutaneous dendritic cells by CpG-containing oligodeoxynucleotides: a role for dendritic cells in the augmentation of Th1 responses by immunostimulatory DNA. J Immunol. Sep. 15, 1998;161(6):3042-9.
Kay et al., Allergy and allergic diseases. Secoond of two parts. N Engl J Med. Jan. 11, 2001;344(2):109-13.
Kataoka et al., Antitumor activity of synthetic oligonucleotides with sequences from cDNA encoding proteins of Mycobacterium bovis BCG. Jpn J Cancer Res. Mar. 1992;83(3):244-7.
Kataoka et al., Immunotherapeutic potential in guinea-pig tumor model of deoxyribonucleic acid from Mycobacterium bovis BCG complexed with poly-L-lysine and carboxymethylcellulose. Jpn J Med Sci Biol. Oct. 1990;43(5):171-82.
Kimura et al., Binding of oligoguanylate to scavenger receptors is required for oligonucleotides to augment NK cell activity and induce IFN. J Biochem (Tokyo). Nov. 1994;116(5):991-4.
Kitagaki et al., CpG Oligodeoxynucleotides in Asthma. In: Microbial DNA and Host Immunity. 2002. Chapter 24: 301-14.
Kitagaki et al., Oral administration of CpG-ODNs suppresses antigen-induced asthma in mice. Clin Exp Immunol. Feb. 2006;143(2):249-59.
Kline et al., Modulation of airway inflammation by CpG oligodeoxynucleotides in a murine model of asthma. J Immunol. Mar. 15, 1998;160(6):2555-9.
Kline et al., The American Federation for Clinical Research, Midwestern section and Eastern section annual meetings. Abstracts. J Investig Med. Sep. 1996;44(7): 380A.
Kline et al., Biomedicine '97. Medical research from bench to bedside. Washington, D.C., Apr. 25-27, 1997. Abstracts. J Investig Med. Mar. 1997;45(3): 282A.
Kline et al., American Federation for Medical Research Midwestern Regional Meeting. Chicago, Illinois, Sep. 25-27, 1997. Abstracts. J Investig Med. Sep. 1997;45(7): 298A.
Kline et al., CpG oligodeoxynucleotides do not require TH1 cytokines to prevent eosinophilic airway inflammation in a murine model of asthma. J Allergy Clin Immunol. Dec. 1999;104(6):1258-64.
Kline et al., Effects of CpG DNA on Th1/Th2 balance in asthma. Curr Top Microbiol Immunol. 2000;247:211-25.
Kline et al., Treatment of established asthma in a murine model using CpG oligodeoxynucleotides. Am J Physiol Lung Cell Mol Physiol. Jul. 2002;283(1):L170-9.
Klinman et al., Contribution of CpG motifs to the immunogenicity of DNA vaccines. J Immunol. Apr. 15, 1997;158(8):3635-9.
Klinman et al., CpG motifs present in bacteria DNA rapidly induce lymphocytes to secrete interleukin 6, interleukin 12, and interferon gamma. Proc Natl Acad Sci U S A. Apr. 2, 1996;93(7):2879-83.
Kou et al., [Analysis and regulation of interferon-gamma production by peripheral blood lymphocytes from patients with bronchial asthma] Arerugi. Mar. 1994;43(3):482-91. Japanese. Abstract Only.
Krieg et al., Lymphocyte activation mediated by oligodeoxynucleotides or DNA containing novel un-methylated CpG motifs. American College of Rheumatology 58th National Scientific Meeting. Minneapolis, Minnesota, Oct. 22, 1994. Abstracts. Arthritis Rheum. Sep. 1994;37(9 Suppl).
Krieg et al., Oligodeoxynucleotide modifications determine the magnitude of B cell stimulation by CpG motifs. Antisense Nucleic Acid Drug Dev. 1996 Summer;6(2):133-9.
Krieg et al., Phosphorothioate oligodeoxynucleotides: antisense or anti-protein? Antisense Res Dev. 1995 Winter;5(4):241.
Krieg et al., Leukocyte stimulation by oligodeoxynucleotides. In: Applied Antisense Oligonucleotide Technology. 1998:431-48.
Krieg, CpG DNA: a pathogenic factor in systemic lupus erythematosus? J Clin Immunol. Nov. 1995;15(6):284-92.
Krieg et al., CpG motifs in bacterial DNA trigger direct B-cell activation. Nature. Apr. 6, 1995;374(6522):546-9.
Krieg et al., The role of CpG dinucleotides in DNA vaccines. Trends Microbiol. Jan. 1998;6(1):23-7.
Krieg, An innate immune defense mechanism based on the recognition of CpG motifs in microbial DNA. J Lab Clin Med. Aug. 1996;128(2):128-33.
Krieg et al., Chapter 8: Immune Stimulation by Oligonucleotides. In: Antisense Research and Application. Crooke, Ed. 1998:243-62.
Krieg et al., Bacterial DNA or oligonucleotides containing CpG motifs protect mice from lethal L. monocytogenes challenge. 1996 Meeting on Molecular Approaches to the Control of Infectious Diseases. Cold Spring Harbor Laboratory, Sep. 9-13, 1996:116.
Krieg et al., The CpG motif: Implications for clinical immunology. BioDrugs. Nov. 1, 1998;10(5):341-6.
Krieg et al., Sequence motifs in adenoviral DNA block immune activation by stimulatory CpG motifs. Proc Natl Acad Sci U S A. Oct. 13, 1998;95(21):12631-6.
Krieg et al., CpG DNA induces sustained IL-12 expression in vivo and resistance to Listeria monocytogenes challenge. J Immunol. Sep. 1, 1998;161(5):2428-34.
Krieg et al., Infection. In: McGraw Hill Book. 1996:242-3.
Krieg et al., Lymphocyte activation by CpG dinucleotide motifs in prokaryotic DNA. Trends Microbiol. Feb. 1996;4(2):73-6.
Krieg, Immune effects and mechanisms of action of CpG motifs. Vaccine. Nov. 8, 2000;19(6):618-22.
Kuramoto et al., Changes of host cell infiltration into Meth A fibrosarcoma tumor during the course of regression induced by injections of a BCG nucleic acid fraction. Int J Immunopharmacol. Jul. 1992;14(5):773-82.
Kuramoto et al., Oligonucleotide sequences required for natural killer cell activation. Jpn J Cancer Res. Nov. 1992;83(11):1128-31.
Kuramoto et al., In situ infiltration of natural killer-like cells induced by intradermal injection of the nucleic acid fraction from BCG. Microbiol Immunol. 1989;33(11):929-40.
LeClerc et al., The preferential induction of a Th1 immune response by DNA-based immunization is mediated by the immunostimulatory effect of plasmid DNA. Cell Immunol. Aug. 1, 1997;179(2):97-106.
Lee et al., Immuno-stimulatory effects of bacterial-derived plasmids depend on the nature of the antigen in intramuscular DNA inoculations. Immunology. Jul. 1998;94(3):285-9.
Leibson et al., Role of gamma-interferon in antibody-producing responses. Nature. Jun. 28-Jul. 4, 1984;309(5971):799-801.
Lipford et al., CpG-containing synthetic oligonucleotides promote B and cytotoxic T cell responses to protein antigen: a new class of vaccine adjuvants. Eur J Immunol. Sep. 1997;27(9):2340-4.
Lipford et al., Immunostimulatory DNA: sequence-dependent production of potentially harmful or useful cytokines. Eur J Immunol. Dec. 1997;27(12):3420-6.
Lipford et al., Bacterial DNA as immune cell activator. Trends Microbiol. Dec. 1998;6(12):496-500.
Liu et al., CpG ODN is an effective adjuvant in immunization with tumor antigen. J Invest Med. Sep. 7, 1997;45(7):333A.
Lukacs et al., Interleukin-4-dependent pulmonary eosinophil infiltration in a murine model of asthma. Am J Respir Cell Mol Biol. May 1994;10(5):526-32.
Lukacs et al., C-C chemokine-induced eosinophil chemotaxis during allergic airway inflammation. J Leukoc Biol. Nov. 1996;60(5):573-8.
Marshall et al., Immunostimulatory sequence DNA linked to the Amb a 1 allergen promotes T(H)1 cytokine expression while downregulating T(H)2 cytokine expression in PBMCs from human patients with ragweed allergy. J Allergy Clin Immunol. Aug. 2001;108(2):191-7.
McCluskie et al., CpG DNA is a potent enhancer of systemic and mucosal immune responses against hepatitis B surface antigen with intranasal administration to mice. J Immunol. Nov. 1, 1998;161(9):4463-6.
Messina et al., The influence of DNA structure on the in vitro stimulation of murine lymphocytes by natural and synthetic polynucleotide antigens. Cell Immunol. Mar. 1993;147(1):148-57.
Mosmann et al., The expanding universe of T-cell subsets: Th1, Th2 and more. Immunol Today, Mar. 1996;17(3):138-46.
Nyce et al., DNA antisense therapy for asthma in an animal model. Nature. Feb. 20, 1997;385(6618):721-5.
Padrid et al., CTLA4Ig inhibits airway eosinophilia and hyperresponsiveness by regulating the development of Th1/Th2 subsets in a murine model of asthma. Am J Respir Cell Mol Biol. Apr. 1998;18(4):453-62.
Pisetsky et al., The immunologic properties of DNA. J Immunol. Jan. 15, 1996;156(2):421-3.
Pisetsky, Immunologic consequences of nucleic acid therapy. Antisense Res Dev. 1995 Fall;5(3):219-25.
Pisetsky et al., Stimulation of in vitro proliferation of murine lymphocytes by synthetic oligodeoxynucleotides. Mol Biol Rep. Oct. 1993;18(3):217-21.
Pisetsky et al., The influence of base sequence on the immunological properties of defined oligonucleotides. Immunopharmacology. Nov. 1998;40(3):199-208.
Raz et al., Potential role of immunostimulatory DNA sequences (ISS) in genetic immunization and autoimmunity. ACR Poster Session C: Cytokines and Inflammatory Mediators. Oct. 20, 1996; Abstract 615.
Raz et al., Preferential induction of a Th1 immune response and inhibition of specific IgE antibody formation by plasmid DNA immunization. Proc Natl Acad Sci U S A. May 14, 1996;93(10):5141-5.
Ricci et al., T cells, cytokines, IgE and allergic airways inflammation. J Investig Allergol Clin Immunol. Sep.-Oct. 1994;4(5):214-20.
Robinson et al., Predominant TH2-like bronchoalveolar T-lymphocyte population in atopic asthma. N Engl J Med. Jan. 30, 1992;326(5):298-304.
Roman et al., Immunostimulatory DNA sequences function as T helper-1-promoting adjuvants. Nat Med. Aug. 1997;3(8):849-54.
Roman et al., Gene immunization for allergic disorders. Springer Semin Immunopathol. 1997;19(2):223-32.
Sato et al., Immunostimulatory DNA sequences necessary for effective intradermal gene immunization. Science. Jul. 19, 1996;273(5273):352-4.
Schwartz et al., CpG motifs in bacterial DNA cause inflammation in the lower respiratory tract. J Clin Invest. Jul. 1, 1997;100(1):68-73.
Serebrisky et al., CpG oligodeoxynucleotides can reverse Th2-associated allergic airway responses and alter the B7.1/B7.2 expression in a murine model of asthma. J Immunol. Nov. 15, 2000;165(10):5906-12.
Sjölander et al., Iscoms containing purified Quillaja saponins upregulate both Th1-like and Th2-like immune responses. Cell Immunol. Apr. 10, 1997;177(1):69-76.
Sonehara et al., Hexamer palindromic oligonucleotides with 5′-CG-3′ motif(s) induce production of interferon. J Interferon Cytokine Res. Oct. 1996;16(10):799-803.
Sparwasser et al., Bacterial DNA causes septic shock. Nature. Mar. 27, 1997;386(6623):336-7.
Sparwasser et al., Macrophages sense pathogens via DNA motifs: induction of tumor necrosis factor-alpha-mediated shock. Eur J Immunol. Jul. 1997;27(7):1671-9.
Spiegelberg et al., DNA-based approaches to the treatment of allergies. Curr Opin Mol Ther. Feb. 2002;4(1):64-71.
Stein et al., Problems in interpretation of data derived from in vitro and in vivo use of antisense oligodeoxynucleotides. Antisense Res Dev. 1994 Summer;4(2):67-9.
Stein et al., Non-antisense effects of oligodeoxynucleotides. Antisense Technology. 1997; ch11: 241-64.
Sun et al. Type I interferon-mediated stimulation of T cells by CpG DNA. J Exp Med. Dec. 21, 1998;188(12):2335-42.
Threadgill et al., Mitogenic synthetic polynucleotides suppress the antibody response to a bacterial polysaccharide. Vaccine. Jan. 1998;16(1):76-82.
Tokunaga et al., A synthetic single-stranded DNA, poly(dG,dC), induces interferon-alpha/beta and -gamma, augments natural killer activity, and suppresses tumor growth. Jpn J Cancer Res. Jun. 1988;79(6):682-6.
Tokunaga et al., Synthetic oligonucleotides with particular base sequences from the cDNA encoding proteins of Mycobacterium bovis BCG induce interferons and activate natural killer cells. Microbiol Immunol. 1992;36(1):55-66.
Van Uden et al., Immunostimulatory DNA and applications to allergic disease. J Allergy Clin Immunol. Nov. 1999;104(5):902-10.
Weeratna et al., Reduction of antigen expression from DNA vaccines by coadministered oligodeoxynucleotides. Antisense Nucleic Acid Drug Dev. Aug. 1998;8(4):351-6.
Weiner et al., Immunostimulatory oligodeoxynucleotides containing the CpG motif are effective as immune adjuvants in tumor antigen immunization. Proc Natl Acad Sci U S A. Sep. 30, 1997;94(20):10833-7.
Weiss et al., Design of protective and therapeutic DNA vaccines for the treatment of allergic diseases. Curr Drug Targets Inflamm Allergy. Oct. 2005;4(5):585-97.
Yamamoto et al., Lipofection of synthetic oligodeoxyribonucleotide having a palindromic sequence of AACGTT to murine splenocytes enhances interferon production and natural killer activity. Microbiol Immunol. 1994;38(10):831-6.
Yamamoto et al., Unique palindromic sequences in synthetic oligonucleotides are required to induce IFN [correction of INF] and augment IFN-mediated [correction of INF] natural killer activity. J Immunol. Jun. 15, 1992;148(12):4072-6.
Yamamoto et al., [Commemorative lecture of receiving Imamura Memorial Prize. II. Mode of action of oligonucleotide fraction extracted from Mycobacterium bovis BCG] Kekkaku. Sep. 1994;69(9):571-4. Japanese.
Yamamoto et al., Ability of oligonucleotides with certain palindromes to induce interferon production and augment natural killer cell activity is associated with their base length. Antisense Res Dev. 1994 Summer;4(2):119-22.
Yamamoto et al., Synthetic olignonucleotides with certain palindromes stimulate interferon production of human peripheral blood lymphocytes in vitro. Jpn J Cancer Res. Aug. 1994;85(8):775-9.
Yamamoto, Cytokine production inducing action of oligo DNA. Rinsho Meneki. 1997; 29(9): 1178-84. Japanese.
Yi et al. Rapid induction of mitogen-activated protein kinases by immune stimulatory CpG DNA. J Immunol. Nov. 1, 1998;161(9):4493-7.
Yi et al., Rapid immune activation by CpG motifs in bacterial DNA. Systemic induction of IL-6 transcription through an antioxidant-sensitive pathway. J Immunol. Dec. 15, 1996;157(12):5394-402.
Yi et al., IFN-gamma promotes IL-6 and IgM secretion in response to CpG motifs in bacterial DNA and oligodeoxynucleotides. J Immunol. Jan. 15, 1996;156(2):558-64.
Yi et al., CpG oligodeoxyribonucleotides rescue mature spleen B cells from spontaneous apoptosis and promote cell cycle entry. J Immunol. Jun. 15, 1998;160(12):5898-906.
Zhao et al., Pattern and kinetics of cytokine production following administration of phosphorothioate oligonucleotides in mice. Antisense Nucleic Acid Drug Dev. Oct. 1997;7(5):495-502.
Zimmermann et al., CpG oligodeoxynucleotides trigger protective and curative Th1 responses in lethal murine leishmaniasis. J Immunol. Apr. 15, 1998;160(8):3627-30.
Patent Interference No. 105,171. Iowa Preliminary Motion 3 (for judgement based on failure to comply with 35 U.S.C. 135(b)). (Electronically filed, unsigned). Jun. 7, 2004.
Patent Interference No. 105,171. Iowa Preliminary Motion 4 (for judgement of no interference in fact). (Electronically filed, unsigned). Jun. 7, 2004.
Patent Interference No. 105,171. Iowa Preliminary Motion 5 (for judgement based on lack of enablement). (Electronically filed, unsigned). Jun. 7, 2004.
Patent Interference No. 105,171. Iowa Preliminary Motion 6 (for judgement based on lack of adequate written description). (Electronically filed, unsigned). Jun. 7, 2004.
Patent Interference No. 105,171. Iowa Preliminary Motion 7 (motion to redefine interference to designate claims as not corresponding to the Count). (Electronically filed, unsigned). Jun. 7, 2004.
Patent Interference No. 105,171. Iowa Preliminary Motion 8 (contingent motion to redefine the Count). (Electronically filed, unsigned). Jun. 7, 2004.
Patent Interference No. 105,171. Iowa Preliminary Motion 9 (motion for benefit of earlier application). (Electronically filed, unsigned). Jun. 7, 2004.
Patent Interference No. 105,171. Iowa Preliminary Motion 10 (contingent motion to redefine the interference by adding a continuation application). (Electronically filed, unsigned). Jul. 2, 2004.
Patent Interference No. 105,171. Regents of the University of California Opposition 3 (to Iowa Preliminary Motion 3 for judgment under 35 USC 135(b)). Sep. 9, 2004.
Patent Interference No. 105,171. Regents of the University of California Opposition 4 (to Iowa Preliminary Motion 4 for judgment of no interference in fact). Sep. 9, 2004.
Patent Interference No. 105,171. Regents of the University of California Opposition 5 (to Iowa Preliminary Motion 5 for judgment that UC's claim is not enabled). Sep. 9, 2004.
Patent Interference No. 105,171. Regents of the University of California Opposition 6 (to Iowa Preliminary Motion 6 for judgment based on lack of adequate written description). Sep. 9, 2004.
Patent Interference No. 105,171. Regents of the University of California Opposition 7 (to Iowa Preliminary Motion 7 to redefine the interference). Sep. 9, 2004.
Patent Interference No. 105,171. Regents of the University of California Opposition 8 (to Iowa Preliminary Motion 8 to redefine the Count). Sep. 9, 2004.
Patent Interference No. 105,171. Regents of the University of California Response 9 (to Iowa Contingent Motion 9 for benefit). Sep. 9, 2004.
Patent Interference No. 105,171. Regents of the University of California Opposition 10 (to Iowa Contingent Motion 10 to redefine the interface). Sep. 9, 2004.
Patent Interference No. 105,171. Regents of the University of California Opposition 11(to Iowa Contingent Motion 11 to suppress). Oct. 15, 2004.
Patent Interference No. 105,171. Iowa Reply 3 (in support of Iowa Preliminary Motion 3 for judgment under 35 U.S.C. §135(b)) (Electronically filed, unsigned). Oct. 15, 2004.
Patent Interference No. 105,171. Iowa Reply 4 (in support of Iowa Preliminary Motion for judgment of no interference in fact) (Electronically filed, unsigned). Oct. 15, 2004.
Patent Interference No. 105,171. Iowa Reply 5 (in support of Iowa Preliminary Motion 5 for judgment that UC's claim 205 is not enabled) (Electronically filed, unsigned). Oct. 15, 2004.
Patent Interference No. 105,171. Iowa Reply 6 (in support of Iowa Preliminary Motion 6 for judgment based on lack of adequate written description) (Electronically filed, unsigned). Oct. 15, 2004.
Patent Interference No. 105,171. Iowa Reply 7 (in support of Iowa Preliminary Motion 7 to refedine the interference) (Electronically filed, unsigned). Oct. 15, 2004.
Patent Interference No. 105,171. Iowa Reply 8 (in support of Iowa Preliminary Motion 8 to redefine the count) (Electronically filed, unsigned). Oct. 15, 2004.
Patent Interference No. 105,171. Iowa Reply 10 (in support of Iowa Preliminary Motion 10 to redefine the interference) (Electronically filed, unsigned). Oct. 15, 2004.
Patent Interference No. 105,171. Iowa Reply 11 (in support of Iowa Miscellaneous Motion to suppress). (Electronically filed, unsigned). Oct. 18, 2004.
Patent Interference No. 105,171. Regents of the University of California Preliminary Statement. Jun. 7, 2004.
Patent Interference No. 105,171. Regents of the University of California Preliminary Motion 1 (to designate additional claims of Iowa patent as corresponding to the Count). Jun. 7, 2004.
Patent Interference No. 105,171. Regents of the University of California Preliminary Motion 2 (for judgment based on lack of written description support and introducting new matter). Jun. 7, 2004.
Patent Interference No. 105,171. Regents of the University of California Preliminary Motion 3 (for judgment based on anticipation). Jun. 7, 2004.
Patent Interference No. 105,171. Regents of the University of California Preliminary Motion 4 (for judgment based on obviousness). Jun. 7, 2004.
Patent Interference No. 105,171. Regents of the University of California Preliminary Motion 5 (for judgment based on anticipation). Jun. 7, 2004.
Patent Interference No. 105,171. Regents of the University of California Preliminary Motion 6 (for judgment based on inequitable conduct). Jun. 7, 2004.
Patent Interference No. 105,171. Regents of the University of California Contingent Preliminary Motion 7 (for benefit of an earlier application under 37 CFR 1.633(j)). Jul. 2, 2004.
Patent Interference No. 105,171. Regents of the University of California Contingent Preliminary Motion 8 (to add additional claims under 37 CFR 1.633(c)(2) and (i)). Jul. 2, 2004.
Amended Claims for Appl. No. 09/265,191, filed Mar. 10, 1999.
Patent Interference No. 105,171. Iowa Opposition 1 (opposition to motion to designate additional claims as corresponding to the Count) (Electronically filed, unsigned). Sep. 9, 2004.
Patent Interference No. 105,171. Iowa Opposition 2 (opposition to motion for judgment based on lack of written description support and introducing new matter) (Electronically filed, unsigned). Sep. 9, 2004.
Patent Interference No. 105,171. Iowa Opposition 3 (opposition to motion for judgment based on anticipation) (Electronically filed, unsigned). Sep. 9, 2004.
Patent Interference No. 105,171. Iowa Opposition 4 (opposition to motion for judgment based on obviousness) (Electrically filed, unsigned). Sep. 9, 2004.
Patent Interference No. 105,171. Iowa Opposition 5 (opposition to motion for judgment based on anticipation) (Electronically filed, unsigned). Sep. 9, 2004.
Patent Interference No. 105,171. Iowa Opposition 6 (opposition to motion for judgment based on inequitable conduct) (Electronically filed, unsigned). (Sep. 9, 2004.
Patent Interference No. 105,171. Iowa Opposition 7 (opposition to motion for benefit of an ealier application under 7 CFR 1.633(j)) (Electronically filed, unsigned). Sep. 9, 2004.
Patent Interference No. 105,171. Iowa Opposition 8 (opposition to motion to add additional claims under 37 CFR 1.633 (2) and (i)) (Electronically filed, unsigned). Sep. 9, 2004.
Patent Interference No. 105,171. Regents of the University of California Reply 1 (to Iowa's opposition to UC's motion to designate Iowa claims as corresponding to the Count). Oct. 15, 2004.
Patent Interference No. 105,171. Regents of the University of California Reply 2 (to Iowa's opposition to UC Preliminary Motion 2 for Judgment). Oct. 15, 2004.
Patent Interference No. 105,171. Regents of the University of California Reply 3 (to Iowa's Opposition to UC Preliminary Motion 3 for Judgment). Oct. 15, 2004.
Patent Interference No. 105,171. Regents of the University of California Reply 4 (to Iowa's Opposition to UC Preliminary Motion 4 for Judgment). Oct. 15, 2004.
Patent Interference No. 105,171. Regents of the University of California Reply 5 (to Iowa's Opposition to UC Preliminary Motion 5 for Judgment). Oct. 15, 2004.
Patent Interference No. 105,171. Regents of the University of California Reply 6 (to Iowa's opposition to UC Preliminary Motion 6 for judgment). Oct. 15, 2004.
Patent Interference No. 105,171. Regents of the University of California Reply 7 (to Iowa's Opposition to UC Preliminary Motion 7 for Benefit). Oct. 15, 2004.
Patent Interference No. 105,171. Regents of the University of California Reply 8 (to Iowa's Opposition to UC Preliminary Motion 8 to add additional claims). Oct. 15, 2004.
Patent Interference No. 105,171. Decision on Motion under 37 CFR §41.125. Mar. 10, 2005.
Patent Interference No. 105,171. Judgment and Order. Mar. 10, 2005.
Patent Interference No. 105,171. Regents of the University of California. Brief of Appellant. Jul. 5, 2005.
Patent Interference No. 105,171. University of Iowa and Coley Pharmaceutical Group, Inc. Brief of Appelles. Aug. 17, 2005.
Patent Interference No. 105,171. Regents of the University of California. Reply Brief of Appellant. Sep. 6, 2005.
Patent Interference No. 105,171. Regents of the University of California. Decision of CAFC. Jul. 17, 2006.
Patent Interference No. 105,526. Krieg Substantive Motion 1 (for unpatentability based on interference estoppel). (Electronically filed, unsigned).
Patent Interference No. 105,526.. Krieg Substantive Motion 2 (for judgment based on inadequate written description and/or enablement). (Electronically filed, unsigned). Jun. 18, 2007.
Patent Interference No. 105,526. Krieg Contingent Responsive Motion (to add new claims 104 and 105). (Electronically filed, unsigned). Jul. 25, 2007.
Patent Interference No. 105,526. Krieg Substantive Motion 3 (for judgment based on prior art). (Electronically filed, unsigned). Jun. 18, 2007.
Patent Interference No. 105,526. Raz Motion 1 (Unpatentability of Krieg Claims under 35 U.S.C. § 112, First Paragraph). (Electronically filed, unsigned). Jun. 18, 2007.
Patent Interference No. 105,526. Raz Motion 2 (Raising a Threshold Issue of No Interference-in-Fact). (Electronically filed, unsigned). Jun. 18, 2007.
Patent Interference No. 105,526.. Raz Motion 3 (Krieg's Claims are Unpatentable Over Prior Art Under 35 U.S.C. § 102(b)) (Electronically filed, unsigned). Jun. 18, 2007.
Patent Interference No. 105,526. Raz Motion 4 (To Designate Krieg Claims 46 and 82-84 as Corresponding to Count 1). (Electronically filed, unsigned). Jun. 18, 2007.
Patent Interference No. 105,526. Raz Responsive Miscellaneous Motion 5 (To revive the Raz Parent Application) (Electronically filed, unsigned) Jul. 25, 2007.
Patent Interference No. 105,526. Raz Contingent Responsive Motion 6 (To Add a New Claim 58) (Electronically filed, unsigned) Jul. 25, 2007.
Patent Interference No. 105,526. Krieg Opposition 1 (Opposition to Motion for Lack of Enablement and Written Description) (Electronically filed, unsigned) Sep. 10, 2007.
Patent Interference No. 105,526. Krieg Opposition 2 (to Raz Motion 2) (Electronically filed, unsigned) Sep. 10, 2007.
Patent Interference No. 105,526. Krieg Opposition 3 (To Raz Motion 3) (Electronically filed, unsiged) Sep. 10, 2007.
Patent Interference No. 105,526. Krieg Opposition 4 (Opposition to Motion for Designating Claims 46 and 82-84 as Corresponding to the Court) (Electronically filed, unsigned) Sep. 10, 2007.
Patent Interference No. 105,526. Raz Opposition 1 (Opposing Krieg Substansive Motion 1) (Electronically filed, unsigned) Sep. 10, 2007.
Patent Interference No. 105,526. Raz Opposition 2 (Opposing Krieg Substantive Motion 2) (Electronically filed, unsigned) Sep. 10, 2007.
Patent Interference No. 105,526. Raz Opposition 4 (Opposing Krieg Contingent Responsive Motion to Add New Claims 104 and 105) (Electronically filed, unsigned) Sep. 10, 2007.
Patent Interference No. 105,526. Krieg Reply 1 (Reply to Raz opposition 1) Oct. 5, 2007.
Patent Interference No. 105,526. Krieg Reply 2 (Reply to Raz opposition 2) Oct. 5, 2007.
Patent Interference No. 105,526. Krieg Reply 4 (Reply to Raz opposition 4) Oct. 5, 2007.
Patent Interference No. 105,526. Raz Reply 1 (Reply to Krieg opposition 1) Oct. 5, 2007.
Patent Interference No. 105,526. Raz Reply 2 (Reply to Krieg opposition 2) Oct. 5, 2007.
Patent Interference No. 105,526. Raz Reply 3 (Reply to Krieg opposition 3) Oct. 5, 2007.
Patent Interference No. 105,526. Raz Reply 4 (Reply to Krieg opposition 4) Oct. 5, 2007.
Patent Interference No. 105,526. Raz Reply 6 (Reply to Krieg opposition 6) Oct. 5, 2007.

Minnifield N. M.

Wolf, Greenfield & Sacks, P.C.
Benson, Gregg C.

RELATED APPLICATIONS

This application is a continuation of U.S. patent application Ser. No. 09/818,918 filed Mar. 27, 2001, now abandoned, which is divisional of U.S. patent application Ser. No. 08/738,652, filed Oct. 30, 1996, now issued as U.S. Pat. No. 6,207,646 B1.

The invention claimed is:

1. A method for of promoting a Th1 immune response in a subject, the method comprising: administering to a subject a first dose of an immunostimulatory nucleic acid; and administering to the subject a second dose of an immunostimulatory nucleic acid, wherein the immunostimulatory nucleic acid comprises a nucleotide sequence comprising 5′-CG-3′ having the formula X₁X₂CGX₃X₄, wherein C is unmethylated and X₁, X₂, X₃ and X₄ are nucleotides and wherein the immunostimulatory nucleic acid is between 8 and 100 nucleotides in length, and includes more than one CpG dinucleotide.

2. The method of claim 1, wherein the second dose is administered about 7 days after the first dose.

3. The method of claim 1, wherein the subject is a human.

4. The method of claim 1, wherein X₁X₂ is GT and X₃X₄ is TT.

GOVERNMENT SUPPORT

The work resulting in this invention was supported in part by National Institute of Health Grant No. R29-AR42556-01. The U.S. Government may therefore be entitled to certain rights in the invention.

BACKGROUND OF THE INVENTION

DNA Binds to Cell Membranes and is Internalized

In the 1970's, several investigators reported the binding of high molecular weight DNA to cell membranes (Lerner, R. A., W. Meinke, and D. A. Goldstein. 1971. “Membrane-associated DNA in the cytoplasm of diploid human lymphocytes”. Proc. Natl. Acad. Sci. USA 68:1212; Agrawal, S. K., R. W. Wagner, P. K. McAllister, and B. Rosenberg. 1975. “Cell-surface-associated nucleic acid in tumorigenic cells made visible with platinum-pyrimidine complexes by electron microscopy”. Proc. Natl. Acad. Sci. USA 72:928). In 1985, Bennett et al. presented the first evidence that DNA binding to lymphocytes is similar to a ligand receptor interaction: binding is saturable, competitive, and leads to DNA endocytosis and degradation into oligonucleotides (Bennett, R. M., G. T. Gabor, and M. M. Merritt. 1985. “DNA binding to human leukocytes. Evidence for a receptor-mediated association, internalization, and degradation of DNA”. J. Clin. Invest. 76:2182). Like DNA, oligodeoxyribonucleotides (ODNs) are able to enter cells in a saturable, sequence independent, and temperature and energy dependent fashion (reviewed in Jaroszewski, J. W., and J. S. Cohen. 1991. “Cellular uptake of antisense oligodeoxynucleotides”. Advanced Drug Delivery Reviews 6:235; Akhtar, S., Y. Shoji, and R. L. Juliano. 1992. “Pharrnaceutical aspects of the biological stability and membrane transport characteristics of antisense oligonucleotides”. In: Gene Regulation: Biology of Antisense RNA and DNA . R. P. Erickson, and J. G. Izant, eds. Raven Press, Ltd. New York, pp. 133; and Zhao, Q., T. Waldschmidt, E. Fisher, C. J. Herrera, and A. M. Krieg., 1994. “Stage specific oligonucleotide uptake in murine bone marrow B cell precursors”. Blood, 84:3660). No receptor for DNA or ODN uptake has yet been cloned, and it is not yet clear whether ODN binding and cell uptake occurs through the same or a different mechanism from that of high molecular weight DNA.

Lymphocyte ODN uptake has been shown to be regulated by cell activation. Spleen cells stimulated with the B cell mitogen LPS had dramatically enhanced ODN uptake in the B cell population, while spleen cells treated with the T cell mitogen Con A showed enhanced ODN uptake by T but not B cells (Krieg, A. M., F. Gmelig-Meyling, M. F. Gourley, W. J. Kisch, L. A. Chrisey, and A. D. Steinberg. 1991. “Uptake of oligodeoxyribonucleotides by lymphoid cells is heterogeneous and inducible”. Antisense Research and Development 1:161).

Immune Effects of Nucleic Acids

Several polynucleotides have been extensively evaluated as biological response modifiers. Perhaps the best example is poly (I,C) which is a potent inducer of IFN production as well as a macrophage activator and inducer of NK activity (Talmadge, J. E., J. Adams, H. Phillips, M. Collins, B. Lenz, M. Schneider, E. Schlick, R. Ruffmann, R. H. Wiltrout, and M. A. Chirigos. 1985. “Immunomodulatory effects in mice of polyinosinic-polycytidylic acid complexed with poly-L-lysine and carboxymethylcellulose”. Cancer Res. 45:1058; Wiltrout, R. H., R. R. Salup, T. A. Twilley, and J. E. Talmadge. 1985. “Immunomodulation of natural killer activity by polyribonucleotides”. J. Biol. Resp. Mod. 4:512; Krown, S. E. 1986. “Interferons and interferon inducers in cancer treatment”. Sem. Oncol. 13:207; and Ewel, C. H., S. J. Urba, W. C. Kopp, J. W. Smith II, R. G. Steis, J. L. Rossio, D. L. Longo, M. J. Jones, W. G. Alvord, C. M. Pinsky, J. M. Beveridge, K. L. McNitt, and S. P. Creekmore. 1992. “Polyinosinic-polycytidylic acid complexed with poly-L-lysine and carboxymethylcellulose in combination with interleukin-2 in patients with cancer: clinical and immunological effects”. Canc. Res. 52:3005). It appears that this murine NK activation may be due solely to induction of IFN-β secretion (Ishikawa, R., and C. A. Biron. 1993. “IFN induction and associated changes in splenic leukocyte distribution”. J. Immunol. 150:3713). This activation was specific for the ribose sugar since deoxyribose was ineffective. Its potent in vitro antitumor activity led to several clinical trials using poly (I,C) complexed with poly-L-lysine and carboxymethylcellulose (to reduce degradation by RNAse) (Talmadge, J. E., et al., 1985. cited supra; Wiltrout, R. H., et al., 1985. cited supra); Krown, S. E., 1986. cited supra); and Ewel, C. H., et al., 1992. cited supra). Unfortunately, toxic side effects have thus far prevented poly (I,C) from becoming a useful therapeutic agent.

Guanine ribonucleotides substituted at the C8 position with either a bromine or a thiol group are B cell mitogens and may replace “B cell differentiation factors” (Feldbush, T. L., and Z. K. Ballas. 1985. “Lymphokine-like activity of 8-mercaptoguanosine: induction of T and B cell differentiation”. J. Immunol. 134:3204; and Goodman, M. G. 1986. “Mechanism of synergy between T cell signals and C8-substituted guanine nucleosides in humoral immunity: B lymphotropic cytokines induce responsiveness to 8-mercaptoguanosine”. J. Immunol. 136:3335). 8-mercaptoguanosine and 8-bromoguanosine also can substitute for the cytokine requirement for the generation of MHC restricted CTL (Feldbush, T. L., 1985. cited supra), augment murine NK activity (Koo, G. C., M. E. Jewell, C. L. Manyak, N. H. Sigal, and L. S. Wicker. 1988. “Activation of murine natural killer cells and macrophages by 8-bromoguanosine”. J. Immunol. 140:3249), and synergize with IL-2 in inducing murine LAK generation (Thompson, R. A., and Z. K. Ballas. 1990. “Lymphokine-activated killer (LAK) cells. V. 8-Mercaptoguanosine as an IL-2-sparing agent in LAK generation”. J. Immunol. 145:3524). The NK and LAK augmenting activities of these C8-substituted guanosines appear to be due to their induction of IFN (Thompson, R. A., et al. 1990. cited supra). Recently, a 5′ triphosphorylated thymidine produced by a mycobacterium was found to be Initogenic for a subset of human γδ T cells (Constant, P., F. Davodeau, M.-A. Peyrat, Y. Poquet, G. Puzo, M. Bonneville, and J.-J. Fournie. 1994. “Stimulation of human γδ T cells by nonpeptidic mycobacterial ligands” Science 264:267). This report indicated the possibility that the immune system may have evolved ways to preferentially respond to microbial nucleic acids.

Several observations suggest that certain DNA structures may also have the potential to activate lymphocytes. For example, Bell et al. reported that nucleosomal protein-DNA complexes (but not naked DNA) in spleen cell supernatants caused B cell proliferation and immunoglobulin secretion (Bell, D. A., B. Morrison, and P. VandenBygaart. 1990. “Immunogenic DNA-related factors”. J. Clin. Invest. 85:1487). In other cases, naked DNA has been reported to have immune effects. For example, Messina et al. have recently reported that 260 to 800 bp fragments of poly (dG)•(dC) and poly (dG•dC) were mitogenic for B cells (Messina, J. P., G. S. Gilkeson, and D. S. Pisetsky. 1993. “The influence of DNA structure on the in vitro stimulation of murine lymphocytes by natural and synthetic polynucleotide antigens”. Cell. Immunol. 147:148). Tokunaga, et al. have reported that dG•dC induces IFN-γ and NK activity (Tokunaga, S. Yamamoto, and K. Namba. 1988. “A synthetic single-stranded DNA, poly(dG,dC), induces interferon-α/β and -γ, augments natural killer activity, and suppresses tumor growth” Jpn. J. Cancer Res. 79:682). Aside from such artificial homopolymer sequences, Pisetsky et al. reported that pure mammalian DNA has no detectable immune effects, but that DNA from certain bacteria induces B cell activation and immunoglobulin secretion (Messina, J. P., G. S. Gilkeson, and D. S. Pisetsky. 1991. “Stimulation of in vitro murine lymphocyte proliferation by bacterial DNA”. J. Immunol. 147:1759). Assuming that these data did not result from some unusual contaminant, these studies suggested that a particular structure or other characteristic of bacterial DNA renders it capable of triggering B cell activation. Investigations of mycobacterial DNA sequences have demonstrated that ODN which contain certain palindrome sequences can activate NK cells (Yamamoto, S., T. Yamamoto, T. Kataoka, E. Kuramoto, O. Yano, and T. Tokunaga. 1992. “Unique palindromic sequences in synthetic oligonucleotides are required to induce fNF and augment INF-mediated natural killer activity”. J. Immunol. 148:4072; Kuramoto, E., O. Yano, Y. Kimura, M. Baba, T. Makino, S. Yamamoto, T. Yamamoto, T. Kataoka, and T. Tokunaga. 1992. “Oligonucleotide sequences required for natural killer cell activation”. Jpn. J. Cancer Res. 83:1128).

Several phosphorothioate modified ODN have been reported to induce in vitro or in vivo B cell stimulation (Tanaka, T., C. C. Chu, and W. E. Paul. 1992. “An antisense oligonucleotide complementary to a sequence in Iγ2b increases γ2b germline transcripts, stimulates B cell DNA synthesis, and inhibits immunoglobulin secretion”. J. Exp. Med. 175:597; Branda, R. F., A. L. Moore, L. Mathews, J. J. McCormack, and G. Zon. 1993. “Immune stimulation by an antisense oligomer complementary to the rev gene of HIV-1 ”. Biochem. Pharmacol. 45:2037; McIntyre, K. W., K. Lombard-Gillooly, J. R. Perez, C. Kunsch, U. M. Sarmiento, J. D. Larigan, K. T. Landreth, and R. Narayanan. 1993. “A sense phosphorothioate oligonucleotide directed to the initiation codon of transcription factor NFκB T65 causes sequence-specific immune stimulation”. Antisense Res. Develop. 3:309; and Pisetsky, D. S., and C. F. Reich. 1993. “Stimulation of murine lymphocyte proliferation by a phosphorothioate oligonucleotide with antisense activity for herpes simplex virus”. Life Sciences 54:101). These reports do not suggest a common structural motif or sequence element in these ODN that might explain their effects.

The CREB/ATF Family of Transcription Factors and Their Role in Replication

The cAMP response element binding protein (CREB) and activating transcription factor (ATF) or CREB/ATF family of transcription factors is a ubiquitously expressed class of transcription factors of which 11 members have so far been cloned (reviewed in de Groot, R. P., and P. Sassone-Corsi: “Hormonal control of gene expression: Multiplicity and versatility of cyclic adenosine 3′,5′-monophosphate-responsive nuclear regulators”. Mol. Endocrin. 7:145, 1993; Lee, K. A. W., and N. Masson: “Transcriptional regulation by CREB and its relatives”. Biochim. Biophys. Acta 1174:221, 1993.). They all belong to the basic region/leucine zipper (bZip) class of proteins. All cells appear to express one or more CREB/ATF proteins, but the members expressed and the regulation of mRNA splicing appear to be tissue-specific. Differential splicing of activation domains can determine whether a particular CREB/ATF protein will be a transcriptional inhibitor or activator. Many CREB/ATF proteins activate viral transcription, but some splicing variants which lack the activation domain are inhibitory. CREB/ATF proteins can bind DNA as homo- or hetero-dimers through the cAMP response element, the CRE, the consensus form of which is the unmethylated sequence TGACGTC (binding is abolished if the CpG is methylated) (Iguchi-Ariga, S. M. M., and W. Schaffner: “CpG methylation of the cAMP-responsive enhancer/promoter sequence TGACGTCA abolishes specific factor binding as well as transcriptional activation”. Genes & Develop. 3:612, 1989.).

The transcriptional activity of the CRE is increased during B cell activation (Xie, H. T. C. Chiles, and T. L. Rothstein: “Induction of CREB activity via the surface Ig receptor of B cells”. J. Immunol. 151:880, 1993.). CREB/ATF proteins appear to regulate the expression of multiple genes through the CRE including immunologically important genes such as fos, jun B, Rb-1, IL-6, IL-1 (Tsukada, J., K. Saito, W. R. Waterman, A. C. Webb, and P. E. Auron: “Transcription factors NF-IL6 and CREB recognize a common essential site in the human prointerleukin 1β gene”. Mol. Cell. Biol. 14:7285, 1994; Gray, G. D., O. M. Hernandez, D. Hebel, M. Root, J. M. Pow-Sang, and E. Wickstrom: “Antisense DNA inhibition of tumor growth induced by c-Ha-ras oncogene in nude mice”. Cancer Res. 53:577, 1993), IFN-β (Du, W., and T. Maniatis: “An ATF/CREB binding site protein is required for virus induction of the human interferon B gene”. Proc. Natl. Acad. Sci. USA 89:2150, 1992), TGF-β1 (Asiedu, C. K., L. Scott, R. K. Assoian, M. Ehrlich: “Binding of AP-1/CREB proteins and of MDBP to contiguous sites downstream of the human TGF-B1 gene”. Biochim. Biophys. Acta 1219:55, 1994.), TGF-β2, class II MHC (Cox, P. M., and C. R. Goding: “An ATF/CREB binding motif is required for aberrant constitutive expression of the MHC class II DRa promoter and activation by SV40 T-antigen”. Nucl. Acids Res. 20:4881, 1992.), E-selectin, GM-CSF, CD-8α, the germline Igα constant region gene, the TCR Vβ gene, and the proliferating cell nuclear antigen (Huang, D., P. M. Shipman-Appasamy, D. J. Orten, S. H. Hinrichs, and M. B. Prystowsky: “Promoter activity of the proliferating-cell nuclear antigen gene is associated with inducible CRE-binding proteins in interleukin 2-stimulated T lymphocytes”. Mol. Cell. Biol. 14:4233, 1994.). In addition to activation through the cAMP pathway, CREB can also mediate transcriptional responses to changes in intracellular Ca ⁺⁺ concentration (Sheng, M., G. McFadden, and M. E. Greenberg: “Membrane depolarization and calcium induce c-fos transcription via phosphorylation of transcription factor CREB”. Neuron 4:571, 1990).

The role of protein-protein interactions in transcriptional activation by CREB/ATF proteins appears to be extremely important. There are several published studies reporting direct or indirect interactions between NFκB proteins and CREB/ATF proteins (Whitley, et. al., (1994) Mol . & Cell. Biol. 14:6464; Cogswell, et al., (1994) J. Immun. 153:712; Hines, et al., (1993) Oncogene 8:3189; and Du, et al., (1993) Cell 74:887. Activation of CREB through the cyclic AMP pathway requires protein kinase A (PKA). which phosphorylates CREB ³⁴¹ on ser ¹³³ and allows it to bind to a recently cloned protein, CBP (Kwok, R. P. S., J. R. Lundblad, J. C. Chrivia, J. P. Richards, H. P. Bachinger, R. G. Brennan, S. G. E. Roberts, M. R. Green, and R. H. Goodman: “Nuclear protein CBP is a coactivator for the transcription factor CREB”. Nature 370:223, 1994; Arias, J., A. S. Alberts, P. Brindle, F. X. Claret, T. Smea, M. Karin, J. Feramisco, and M. Montminy: “Activation of cAMP and mitogen responsive genes relies on a common nuclear factor”. Nature 370:226, 1994.). CBP in turn interacts with the basal transcription factor TFIIB causing increased transcription. CREB also has been reported to interact with dTAFII 110, a TATA binding protein-associated factor whose binding may regulate transcription (Ferreri, K., G. Gill, and M. Montminy: “The cAMP-regulated transcription factor CREB interacts with a component of the TFIID complex”. Proc. Natl. Acad. Sci. USA 91:1210, 1994.). In addition to these interactions, CREB/ATF proteins can specifically bind multiple other nuclear factors (Hoeffler, J. P., J. W. Lustbader, and C.-Y. Chen: “Identification of multiple nuclear factors that interact with cyclic adenosine 3′,5′-monophosphate response element-binding protein and activating transcription factor-2 by protein-protein interactions”. Mol. Endocrinol. 5:256, 1991) but the biologic significance of most of these interactions is unknown. CREB is normally thought to bind DNA either as a homodimer or as a heterodimer with several other proteins. Surprisingly, CREB monomers constitutively activate transcription (Krajewski, W., and K. A. W. Lee: “A monomeric derivative of the cellular transcription factor CREB functions as a constitutive activator”. Mol. Cell. Biol. 14:7204, 1994.).

Aside from their critical role in regulating cellular transcription, it has recently been shown that CREB/ATF proteins are subverted by some infectious viruses and retroviruses, which require them for viral replication. For example, the cytomegalovirus immediate early promoter, one of the strongest known mammalian promoters, contains eleven copies of the CRE which are essential for promoter function (Chang, Y.-N., S. Crawford, J. Stall, D. R. Rawlins, K.-T. Jeang, and G. S. Hayward: “The palindromic series I repeats in the simian cytomegalovirus major immediate-early promoter behave as both strong basal enhancers and cyclic AMP response elements”. J. Virol. 64:264, 1990). At least some of the transcriptional activating effects of the adenovirus E1A protein, which induces many promoters, are due to its binding to the DNA binding domain of the CREB/ATF protein, ATF-2, which mediates E1A inducible transcription activation (Liu, F., and M. R. Green: “Promoter targeting by adenovirus E1a through interaction with different cellular DNA-binding domains”. Nature 368:520, 1994). It has also been suggested that E1A binds to the CREB-binding protein, CBP (Arany, Z., W. R. Sellers, D. M. Livingston, and R. Eckner: “E1A-associated p300 and CREB-associated CBP belong to a conserved family of coactivators”. Cell 77:799, 1994). Human T lymphotropic virus-I (HTLV-1), the retrovirus which causes human T cell leukemia and tropical spastic paresis, also requires CREB/ATF proteins for replication. In this case, the retrovirus produces a protein, Tax, which binds to CREB/ATF proteins and redirects them from their normal cellular binding sites to different DNA sequences (flanked by G- and C-rich sequences) present within the HTLV transcriptional enhancer (Paca-Uccaralertkun, S., L.-J. Zhao, N. Adya, J. V. Cross, B. R. Cullen, I. M. Boros, and C.-Z. Giam: “In vitro selection of DNA elements highly responsive to the human T-cell lymphotropic virus type I transcriptional activator, Tax”. Mol. Cell. Biol. 14:456, 1994; Adya, N., L.-J. Zhao, W. Huang, I. Boros, and C.-Z. Giam: “Expansion of CREB's DNA recognition specificity by Tax results from interaction with Ala-Ala-Arg at positions 282-284 near the conserved DNA-binding domain of CREB”. Proc. Natl. Acad. Sci. USA 91:5642, 1994).

SUMMARY OF THE INVENTION

The instant invention is based on the finding that certain nucleic acids containing unmethylated cytosine-guanine (CpG) dinucleotides activate lymphocytes in a subject and redirect a subject's immune response from a Th2 to a Th1 (e.g. by inducing monocytic cells and other cells to produce Th1 cytokines, including IL-12, IFN-γ and GM-CSF). Based on this finding, the invention features, in one aspect, novel immunostimulatory nucleic acid compositions.

In a preferred embodiment, the immunostimulatory nucleic acid contains a consensus mitogenic CpG motif represented by the formula:

5′ X1CGX2 3′

wherein X ₁ is selected from the group consisting of A,G and T; and X ₂ is C or T.

In a particularly preferred embodiment an immunostimulatory nucleic acid molecule contains a consensus mitogenic CpG motif represented by the formula:

5′ X1X2CGX3X4 3′

wherein C and G are unmethylated; and X ₁ , X ₂ , X ₃ and X ₄ are nucleotides.

Enhanced immunostimulatory activity of human cells occurs where X ₁ X ₂ is selected from the group consisting of GpT, GpG, GpA and ApA and/or X ₃ X ₄ is selected from the group consisting of TpT, CpT and GpT (Table 5). For facilitating uptake into cells, CpG containing immunostimulatory nucleic acid molecules are preferably in the range of 8 to 40 base pairs in size. However, nucleic acids of any size (even many kb long) are immunostimulatory if sufficient immunostimulatory motifs are present, since such larger nucleic acids are degraded into oligonucleotides inside of cells. Preferred synthetic oligonucleotides do not include a GCG trinucleotide sequence at or near the 5′ and/or 3′ terminals and/or the consensus mitogenic CpG motif is not a palindrome. Prolonged immunostimulation can be obtained using stabilized oligonucleotides, particularly phosphorothioate stabilized oligonucleotides.

In a second aspect, the invention features useful therapies, which are based on the immunostimulatory activity of the nucleic acid molecules. For example, the immunostimulatory nucleic acid molecules can be used to treat, prevent or ameliorate an immune system deficiency (e.g., a tumor or cancer or a viral, fungal, bacterial or parasitic infection in a subject). In addition, immunostimulatory nucleic acid molecules can be administered to stimulate a subject's response to a vaccine.

Further, by redirecting a subject's immune response from Th2 to Th1, the instant claimed nucleic acid molecules can be administered to treat or prevent the symptoms of asthma. In addition, the instant claimed nucleic acid molecules can be administered in conjunction with a particular allergen to a subject as a type of desensitization therapy to treat or prevent the occurrence of an allergic reaction.

Further, the ability of immunostimulatory nucleic acid molecules to induce leukemic cells to enter the cell cycle supports the use of immunostimulatory nucleic acid molecules in treating leukemia by increasing the sensitivity of chronic leukemia cells and then administering conventional ablative chemotherapy, or combining the immunostimulatory nucleic acid molecules with another immunotherapy.

Other features and advantages of the invention will become more apparent from the following detailed description and claims.

BRIEF DESCRIPTION OF THE FIGURES

FIG. 1A-C are graphs plotting dose-dependent IL-6 production in response to various DNA sequences in T cell depleted spleen cell cultures. A. E. coli DNA (●) and calf thymus DNA (▪) sequences and LPS (at 10× the concentration of E. coli and calf thymus DNA) (♦). B. Control phosphodiester oligodeoxynucleotide (ODN) ^5′ ATGGAAGGTCCAGTGTTCTC ^3′ (SEQ ID NO:1) (▪) and two phosphodiester CpG ODN ^5′ ATCGACCTACGTGCGTTCTC ^3′ (SEQ ID NO:2) (♦) and ^5′ TCCATAACGTTCCTGATGCT ^3′ (SEQ ID NO:3) (●). C. Control phosphorothioate ODN ^5′ GCTAGATGTTAGCGT ³ ′ (SEQ ID NO:4) (▪) and two phosphorothioate CpG ODN ^5′ GAGAACGTCGACCTTCGAT ³ ′ (SEQ ID NO:5) (♦) and ^5′ GCATGACGTTGAGCT ^3′ (SEQ ID NO:6) (●). Data present the mean±standard deviation of triplicates.

FIG. 2 is a graph plotting IL-6 production induced by CpG DNA in vivo as determined 1-8 hrs after injection. Data represent the mean from duplicate analyses of sera from two mice. BALB/c mice (two mice/group) were injected iv. with 100 μl of PBS (□) or 200 μg of CpG phosphorothioate ODN 5′ TCCATGACGTTCCTGATGCT 3′ (SEQ ID NO:7) (▪) or non-CpG phosphorothioate ODN 5′ TCCATGAGCTTCCTGAGTCT 3′ (SEQ ID NO:8) (♦).

FIG. 3 is an autoradiograph showing IL-6 mRNA expression as determined by reverse transcription polymerase chain reaction in liver, spleen, and thymus at various time periods after in vivo stimulation of BALB/c mice (two mice/group) injected iv with 100 μl of PBS, 200 μg of CpG phosphorothioate ODN 5′ TCCATGACGTTCCTGATGCT 3′ (SEQ ID NO:7) or non-CpG phosphorothioate ODN 5′ TCCATGAGCTTCCTGAGTCT 3′ (SEQ ID NO:8).

FIG. 4A is a graph plotting dose-dependent inhibition of CpG-induced IgM production by anti-IL-6. Splenic B-cells from DBA/2 mice were stimulated with CpG ODN ^5′ TCCAAGACGTTCCTGATGCT ^3′ (SEQ ID NO:9) in the presence of the indicated concentrations of neutralizing anti-IL-6 (♦) or isotype control Ab (●) and IgM levels in culture supernatants determined by ELISA. In the absence of CpG ODN, the anti-IL-6 Ab had no effect on IgM secretion (▪).

FIG. 4B is a graph plotting the stimulation index of CpG-induced splenic B cells cultured with anti-IL-6 and CpG S-ODN 5′ TCCATGACGTTCCTGATGCT 3′ (SEQ ID NO:7) (♦) or anti-IL-6 antibody only (▪). Data present the mean±standard deviation of triplicates.

FIG. 5 is a bar graph plotting chloramphenicol acetyltransferase (CAT) activity in WEHI-231 cells transfected with a promoter-less CAT construct (pCAT), positive control plasmid (RSV), or IL-6 promoter-CAT construct alone or cultured with CpG 5′ TCCATGACGTTCCTGATGCT 3′ (SEQ ID NO:7) or non-CpG 5′ TCCATGAGCTTCCTGAGTCT 3′ (SEQ ID NO:8) phosphorothioate ODN at the indicated concentrations. Data present the mean of triplicates.

FIG. 6 is a schematic overview of the immune effects of the immunostimulatory unmethylated CpG containing nucleic acids, which can directly activate both B cells and monocytic cells (including macrophages and dendritic cells) as shown. The immunostimulatory oligonucleotides do not directly activate purified NK cells, but render them competent to respond to IL-12 with a marked increase in their IFN-γ production. By inducing IL-12 production and the subsequent increased IFN-γ secretion by NK cells, the immunostimulatory nucleic acids promote a Th1 type immune response. No direct activation of proliferation of cytokine secretion by highly purified T cells has been found. However, the induction of Th1 cytokine secretion by the immunostimulatory oligonucleotides promotes the development of a cytotoxic lymphocyte response.

FIG. 7 is an autoradiograph showing NFκB mRNA induction in monocytes treated with E. coli (EC) DNA (containing unmethylated CpG motifs), control (CT) DNA (containing no unmethylated CpG motifs) and lipopolysaccharide (LPS) at various measured times, 15 and 30 minutes after contact.

FIG. 8A shows the results from a flow cytometry study using mouse B cells with the dihydrorhodamine 123 dye to determine levels of reactive oxygen species. The dye only sample in Panel A of the figure shows the background level of cells positive for the dye at 28.6%. This level of reactive oxygen species was greatly increased to 80% in the cells treated for 20 minutes with PMA and ionomycin, a positive control (Panel B). The cells treated with the CpG oligo (TCCATGACGTTCCTGACGTT SEQ ID NO:10) also showed an increase in the level of reactive oxygen species such that more than 50% of the cells became positive (Panel D). However, cells treated with an oligonucleotide with the identical sequence except that the CpGs were switched (TCCATGAGCTTCCTGAGTGCT SEQ ID NO:11) did not show this significant increase in the level of reactive oxygen species (Panel E).

FIG. 8B shows the results from a flow cytometry study using mouse B cells in the presence of chloroquine with the dihydrorhodamine 123 dye to determine levels of reactive oxygen species. Chloroquine slightly lowers the background level of reactive oxygen species in the cells such that the untreated cells in Panel A have only 4.3% that are positive. Chloroquine completely abolishes the induction of reactive oxygen species in the cells treated with CpG DNA (Panel B) but does not reduce the level of reactive oxygen species in the cells treated with PMA and ionomycin (Panel E).

FIG. 9 is a graph plotting lung lavage cell count over time. The graph shows that when the mice are initially injected with Schistosoma mansoni eggs “egg”, which induces a Th2 immune response, and subsequently inhale Schistosoma mansoni egg antigen “SEA” (open circle), many inflammatory cells are present in the lungs. However, when the mice are initially given CpG oligo (SEQ ID NO:10) along with egg, the inflammatory cells in the lung are not increased by subsequent inhalation of SEA (open triangles).

FIG. 10 is a graph plotting lung lavage eosinophil count over time. Again, the graph shows that when the mice are initially injected with egg and subsequently inhale SEA (open circle), many eosinophils are present in the lungs. However, when the mice are initially given CpG oligo (SEQ ID NO:10) along with egg, the inflammatory cells in the lung are not increased by subsequent inhalation of the SEA (open triangles).

FIG. 11 is a bar graph plotting the effect on the percentage of macrophage, lymphocyte, neutrophil and eosinophil cells induced by exposure to saline alone; egg, then SEA; egg and SEQ ID NO:11, then SEA; and egg and control oligo (SEQ ID NO:11), then SEA. When the mice are treated with the control oligo at the tine of the initial exposure to the egg, there is little effect on the subsequent influx of eosinophils into the lungs after inhalation of SEA. Thus, when mice inhale the eggs on days 14 or 21, they develop an acute inflammatory response in the lungs. However, giving a CpG oligo along with the eggs at the time of initial antigen exposure on days 0 and 7 almost completely abolishes the increase in eosinophils when the mice inhale the egg antigen on day 14.

FIG. 12 is a bar graph plotting eosinophil count in response to injection of various amounts of the protective oligo SEQ ID NO:10.

FIG. 13 is a graph plotting interleukin 4 (IL-4) production (pg/ml) in mice over time in response to injection of egg, then SEA (open diamond); egg and SEQ ID NO:10, then SEA (open circle); or saline, then saline (open square). The graph shows that the resultant inflammatory response correlates with the levels of the Th2 cytokine IL-4 in the lung.

FIG. 14 is a bar graph plotting interleukin 12 (IL-12) production (pg/ml) in mice over time in response to injection of saline; egg, then SEA; or SEQ ID NO:10 and egg, then SEA. The graph shows that administration of an oligonucleotide containing an unmethylated CpG motif can actually redirect the cytokine response of the lung to production of IL-12, indicating a Th1 type of immune response.

FIG. 15 is a bar graph plotting interferon gamma (IFN-γ) production (pg/ml) in mice over time in response to injection of saline; egg, then saline; or SEQ ID NO:10 and egg, then SEA. The graph shows that administration of an oligonucleotide containing an umnethylated CpG motif can also redirect the cytokine response of the lung to production of INF-γ, indicating a Th1 type of immune response.

DETAILED DESCRIPTION OF THE INVENTION

Definitions

As used herein, the following terms and phrases shall have the meanings set forth below:

An “allergen” refers to a substance that can induce an allergic or asthmatic response in a susceptible subject. The list of allergens is enormous and can include pollens, insect venoms, animal dander, dust, fungal spores and drugs (e.g. penicillin). Examples of natural, animal and plant allergens include proteins specific to the following genera: Canine ( Canisfamiliaris ); Dermatophagoides (e.g. Dermatophagoidesfarinae ); Felis ( Felis domesticus ); Ambrosia ( Ambrosia artemiisfolia; Lolium (e.g. Lolium perenne or Lolium multiflorum ); Cryptomeria ( Cryptomeriajaponica ); Alternaria ( Alternaria alternata ); Alder; Alnus ( Alnus gultinosa ); Betula ( Betula verrucosa ); Quercus ( Quercus alba ); Olea ( Olea europa ); Artemisia ( Artemisia vulgaris ); Plantago (e.g. Plantago lanceolata ); Parietaria (e.g. Parietaria officinalis or Parietaria judaica ); Blattella (e.g. Blattella germanica ); Apis (e.g. Apis multiflorum ); Cupressus (e.g. Cupressus sempervirens, Cupressus arizonica and Cupressus macrocarpa ); Juniperus (e.g. Juniperus sabinoides, Juniperus virginiana, Juniperus communis and Juniperus ashei ); Thuya (e.g. Thuya orientalis ); Chamaecyparis (e.g. Chamaecyparis obtusa ); Periplaneta (e.g. Periplaneta americana ); Agropyron (e.g. Agropyron repens ); Secale (e.g. Secale cereale ); Triticum (e.g. Triticum aestivum ); Dactylis (e.g. Dactylis glomerata ); Festuca (e.g. Festuca elatior ); Poa (e.g. Poapratensis or Poa compressa ); Avena (e.g. Avena sativa ); Holcus (e.g. Holcus lanatus ); Anthoxanthum (e.g. Anthoxanthum odoratum ); Arrhenatherum (e.g. Arrhenatherum elatius ); Agrostis (e.g. Agrostis alba ); Phleum (e.g. Phleum pratense ); Phalaris (e.g. Phalaris arundinacea ); Paspalum (e.g. Paspalum notatum ); Sorghum (e.g. Sorghum halepensis ); and Bromus (e.g. Bromus inermis ).

An “allergy” refers to acquired hypersensitivity to a substance (allergen). Allergic conditions include eczema, allergic rhinitis or coryza, hay fever, bronchial asthma, urticaria (hives) and food allergies, and other atopic conditions.

“Asthma”—refers to a disorder of the respiratory system characterized by inflammation, narrowing of the airways and increased reactivity of the airways to inhaled agents. Asthma is frequently, although not exclusively associated with atopic or allergic symptoms.

An “immune system deficiency” shall mean a disease or disorder in which the subject's immune system is not functioning in normal capacity or in which it would be useful to boost a subject's immune response for example to eliminate a tumor or cancer (e.g. tumors of the brain, lung (e.g. small cell and non-small cell), ovary, breast, prostate, colon, as well as other carcinomas and sarcomas) or an infection in a subject.

Examples of infectious virus include: Retroviridae (e.g., human immunodeficiency viruses, such as HIV-1 (also referred to as HTLV-III, LAV or HTLV-III/LAV, or HIV-III; and other isolates, such as HIV-LP; Picornaviridae (e.g., polio viruses, hepatitis A virus; enteroviruses, human coxsackie viruses, rhinoviruses, echoviruses); Calciviridae (e.g., strains that cause gastroenteritis); Togaviridae (e.g., equine encephalitis viruses, rubella viruses); Flaviridae (e.g., dengue viruses, encephalitis viruses, yellow fever viruses); Coronaviridae (e.g., coronaviruses); Rhabdoviridae (e.g., vesicular stomatitis viruses, rabies viruses); Filoviridae (e.g., ebola viruses); Paramyxoviridae (e.g., parainfluenza viruses, mumps virus, measles virus, respiratory syncytial virus); Orthomyxoviridae (e.g., influenza viruses); Bungaviridae (e.g., Hantaan viruses, bunga viruses, phleboviruses and Nairo viruses); Arena viridae (hemorrhagic fever viruses); Reoviridae (e.g., reoviruses, orbiviurses and rotaviruses); Birnaviridae; Hepadnaviridae (Hepatitis B virus); Parvoviridae (parvoviruses); Papovaviridae (papilloma viruses, polyoma viruses); Adenoviridae (most adenoviruses); Herpesviridae (herpes simplex virus (HSV) 1 and 2, varicella zoster virus, cytomegalovirus (CMV), herpes viruses'); Poxviridae (variola viruses, vaccinia viruses, pox viruses); and Iridoviridae (e.g., African swine fever virus); and unclassified viruses (e.g., the etiological agents of Spongiform encephalopathies, the agent of delta hepatitis (thought to be a defective satellite of hepatitis B virus), the agents of non-A, non-B hepatitis (class 1=internally transmitted; class 2=parenterally transmitted (i.e., Hepatitis C); Norwalk and related viruses, and astroviruses).

Examples of infectious bacteria include: Helicobacter pyloris, Borelia burgdorferi, Legionella pneumophilia, Mycobacteria spp. (e.g., M. tuberculosis, M. avium, M. intracellulare, M. kansasii, M. gordonae ), Staphylococcus aureus, Neisseria gonorrhoeae, Neisseria meningitidis, Listeria monocytogenes, Streptococcus pyogenes (Group A Streptococcus), Streptococcus agalactiae (Group B Streptococcus), Streptococcus (viridans group), Streptococcus faecalis, Streptococcus bovis, Streptococcus ( anaerobic spp.), Streptococcus pneumoniae , pathogenic Campylobacter sp., Enterococcus sp., Haemophilus influenzae, Bacillus anthracis, Corynebacterium diphtheriae, Corynebacterium sp., Erysipelothrix rhusiopathiae, Clostridium perfringens, Clostridium tetani, Enterobacter aerogenes, Klebsiella pneumoniae, Pasturella multocida, Bacteroides sp., Fusobacterium nucleatum, Streptobacillus monilifor