| 5023252 | Transdermal and trans-membrane delivery of drugs | June, 1991 | Hseih | 514/183 |
| 5034506 | Uncharged morpholino-based polymers having achiral intersubunit linkages | July, 1991 | Summerton et al. | 528/391 |
| 5225347 | Therapeutic ribozyme compositions and expression vectors | July, 1993 | Goldberg et al. | 435/320.1 |
| 5580859 | Delivery of exogenous DNA sequences in a mammal | December, 1996 | Felgner et al. | 514/44 |
| 5719262 | Peptide nucleic acids having amino acid side chains | February, 1998 | Buchardt et al. | 530/300 |
| 5766855 | Peptide nucleic acids having enhanced binding affinity and sequence specificity | June, 1998 | Buchardt et al. | 435/6 |
| 5834279 | Methods of identifying compounds that inhibit DNA synthesis in mycobacterium tuberculosis and compositions, reagents and kits for performing the same | November, 1998 | Rubin et al. | 435/189 |
| 5998383 | Antitumor antisense sequences directed against ribonucleotide reductase | December, 1999 | Wright et al. | 514/44 |
| 6121000 | Antitumor antisense sequences directed against R1 and R2 components of ribonucleotide reductase | September, 2000 | Wright et al. | 435/6 |
| 20060241070 | Antisense oligonucleotides directed to ribonucleotide reductase r2 and uses thereof in the treament of cancer | October, 2006 | Wright et al. |
| EP0383190 | August, 1990 | Ribonucleotide reductase inhibitors. | ||
| WO/1994/021661 | September, 1994 | CELLULAR REGULATION WITH RIBOREGULATORS | ||
| WO/1995/002069 | January, 1995 | OLIGONUCLEOTIDE MODULATION OF PROTEIN KINASE C | ||
| WO/1998/000532 | January, 1998 | OLIGONUCLEOTIDES FROM THE UNTRANSLATED REGIONS OF RIBONUCLEOTIDE REDUCTASE AND THEIR USE TO MODULATE CELL GROWTH | ||
| WO/1998/005769 | December, 1998 | ANTITUMOR ANTISENSE SEQUENCES DIRECTED AGAINST R1 AND R2 COMPONENTS OF RIBONUCLEOTIDE REDUCTASE | ||
| WO/1999/002673 | January, 1999 | ANTISENSE OLIGONUCLEOTIDE SEQUENCES AS INHIBITORS OF MICROORGANISMS |
This application is a Continuation of Ser. No. 09/249,247 filed Feb. 11, 1999 now U.S. Pat. No. 6,593,305 which is a Continuation-In-Part Application of U.S. patent application Ser. No. 08/904,901 filed Aug. 1, 1997, now U.S. Pat. No. 5,998,383 which in turn claims priority to U.S. Provisional Application No. 60/023,040 filed Aug. 2, 1996 and U.S. Provisional Application No. 60/039,959 file Mar. 7, 1997, each of which is incorporated herein by reference in its entirety.
The field of this invention relates to methods of controlling the tumorigenicity and/or metastasis of neoplastic cells. Specifically it relates to the use of antisense sequences directed against the R1 and R2 components of mammalian ribonucleotide reductase.
The following publications, patent applications and patents are cited in this application:
All of the above publications, patent applications and patents are herein incorporated by reference in their entirety to the same extent as if each individual publication, patent application or patent was specifically and individually indicated to be incorporated by reference in its entirety.
The first unique step leading to DNA synthesis is the conversion of ribonucleotides to their corresponding deoxyribonucleotides, a reaction that is catalyzed in a cell cycle specific manner by the housekeeping gene ribonucleotide reductase [Lewis et al., 1978; Reichard, 1993; Wright, 1989a; Wright et al., 1990a; Stubbe, 1989]. The mammalian enzyme is composed of two dissimilar dimeric protein components often called R1 and R2, which are encoded by two different genes located on different chromosomes [Bjorklund et al., 1993; Tonin et al., 1987]. Mammalian protein R1 is a homodimeric structure, with a molecular weight of about 170 kDa, and has substrate sites and allosteric effector sites that control enzyme activity and substrate specificity [Wright, 1989A; Thelander et al., 1980; Caras et al., 1985; Wright et al., 1990a]. Protein R2 is a homodimer, with a molecular weight of 88 kDa, and forms two equivalent dinuclear iron centers that stabilizes a tyrosyl free radical required for catalysis [Wright et al., 1990a; Thelander et al., 1985; McClarty et al., 1990]. R1 and R2 proteins interact at their C-terminal ends to form an active holoenzyme [Reichard, 1993; Wright et al., 1990a; Davis et al., 1994].
R1 and R2 are differentially regulated during the cell cycle. There is an S-phase correlated increase in the R2 protein resulting from its de novo synthesis [Lewis et al., 1978; Mann et al., 1988]. The activity of ribonucleotide reductase, and therefore DNA synthesis and cell proliferation, is controlled in proliferating cells during the cell cycle by the synthesis and degradation of the R2 component [Eriksson et al., 1984]. The rate-limiting R2 component is a phosphoprotein capable of being phosphorylated by the CDC2 and CDK2 protein kinase mediators of cell cycle progression [Chan et al., 1993], and contains non-heme iron that stabilizes an unique tyrosyl free radical required for enzyme activity [Reichard, 1993; McClarty et al., 1990.
The levels of the R1 protein do not appear to change substantially during the cell cycle of proliferating cells and can be detected throughout the cell cycle. Synthesis of R1 mRNA, like R2 mRNA appears to occur mainly during S phase [Eriksson et al., 1984; Choy et al., 1988; Mann et al., 1988]. The broader distribution of the R1 protein during the cell cycle is attributed to its longer half life as compared to the R2 protein [Choy et al., 1988; Mann et al., 1988].
Regulation of ribonucleotide reductase, and particularly the R2 component, is altered in malignant cells exposed to tumor promoters or to the growth factor TGF-β [Amara, et al., 1994; Chen et al., 1993; Amara et al., 1995b; Hurta and Wright, 1995A; Hurta et al., 1991]. Higher levels of enzyme activity have been observed in cultured malignant cells when compared to nonmalignant cells [Weber, 1983; Takeda and Weber, 1981; Wright et al., 1989a], and increased levels of R2 protein and R2 mRNA have been found in pre-malignant and malignant tissues as compared to normal control tissue samples [Saeki et al., 1995; Jensen et al., 1994].
Compounds like hydroxyurea inhibit ribonucleotide reductase activity by destabilizing the iron center of the R2 protein causing the destruction of the tyrosyl free radical [McClarty et al., 1990], and preventing cells from progressing through S-phase of the cell cycle [Ashihara and Baserga, 1979].
Breakthroughs in molecular biology and the human genome project have opened previously unforeseen possibilities for targeted intervention with mammalian gene expression [Blaese, 1997]. These include approaches such as disruption of specific genes. Antisense (AS) oligonucleotides (AS-ON) designed to hybridize with specific sequences within a targeted mRNA are one example of such targeted intervention. In general, antisense oligonucleotides interact well with phospholipid membranes [Akhter et al., 1991]. Following their interaction with the cellular plasma membrane, they may be actively, or passively, transported into living cells [Loke et al., 1989], and this may occur by a saturable mechanism predicted to involve specific receptors [Yakubov et al., 1989].
Many excellent reviews have covered the main aspects of antisense technology and its enormous therapeutic potential. There are reviews on the chemical [Crooke, 1995], cellular [Wagner, 1994] and therapeutic [Hanania, et al., 1995; Scanlon, et al., 1995; Gewirtz, 1993] aspects of this rapidly developing technology. Within a relatively short time, ample information has accumulated about the in vitro use of antisense oligonucleotides in cultured primary cells and cell lines as well as for in vivo administration of such oligonucleotides for suppressing specific processes and changing body functions in a transient manner. Further, enough experience is now available in vitro and in vivo in animal models to predict human efficacy.
It would be useful to have antisense oligonucleotides available to control tumorigenicity and/or metastatic potential in premalignant or malignant cell wherein the R1 and R2 components of ribonucleotide reductase were utilized.
The present invention provides an isolated antisense oligonucleotide from at least about three nucleotides or nucleotide analogues to about fifty nucleotides in length comprising a sequence complementary to a mRNA sequence of a mammalian ribonucleotide reductase protein component R1 or sequence segment thereof. This sequence may further comprise a reduced dimer formation and reduced self-complementary interactions.
Another aspect of this invention is a synthetic antisense oligonucleotide from at least about three nucleotides or nucleotide analogues to about fifty nucleotides in length comprising a sequence complementary to a mRNA sequence of a mammalian ribonucleotide reductase protein component R2 or sequence segment thereof. This sequence may further comprise a reduced dimer formation and reduced self-complementary interactions.
Also provided is a pharmaceutical composition for inhibiting tumor cell growth in a mammal comprising an effective amount of the antisense oligonucleotide from at least about three nucleotides or nucleotide analogues to about fifty nucleotides in length comprising a sequence complementary to a mRNA sequence of a mammalian ribonucleotide reductase protein component R1 or sequence segment thereof and a pharmaceutically acceptable carrier or diluent.
Also provided is a pharmaceutical composition for inhibiting tumor cell growth in a mammal comprising an effective amount of the antisense oligonucleotide from at least about three nucleotides or nucleotide analogues to about fifty nucleotides in length comprising a sequence complementary to a mRNA sequence of a mammalian ribonucleotide reductase protein component R2 or sequence segment thereof and a pharmaceutically acceptable carrier or diluent.
In one of its method aspects, this invention provides a method of inhibiting the tumorigenicity of neoplastic cells in a mammal which method comprises contacting the neoplastic cell with an effective amount of at least one antisense oligonucleotide from at least about three nucleotides or nucleotide analogues to about fifty nucleotides in length comprising a sequence selected from the group consisting of sequences complementary to a mRNA sequence of a mammalian ribonucleotide reductase protein component R1 or sequence segment thereof or sequences complementary to a mRNA sequence of a mammalian ribonucleotide reductase protein component R2 or sequence segment thereof.
Another aspect is a method of inhibiting the tumorigenicity of neoplastic cells resistant to chemotherapeutic drugs in a mammal which method comprises identifying patients who have tumors that are resistant to a chemotherapeutic drug; and contacting the tumor with the chemotherapeutic drug to which the tumor is resistant and an antisense oligonucleotide from at least about three nucleotides or nucleotide analogues to about fifty nucleotides in length comprising a sequence selected from the group consisting of sequences complementary to a mRNA sequence of a mammalian ribonucleotide reductase protein component R1 or sequence segment thereof or sequences complementary to a mRNA sequence of a mammalian ribonucleotide reductase protein component R2 or sequence segment thereof wherein the amount of the chemotherapeutic drug and the antisense oligonucleotide is sufficient to inhibit tumor cell growth. The amount of antisense oligonucleotide alone may be insufficient to inhibit tumor cell growth.
Another aspect is a method of increasing sensitivity of neoplastic cells to chemotherapeutic drugs in a mammal by contacting the tumor with an antisense oligonucleotide from at least about three nucleotides or nucleotide analogues to about fifty nucleotides in length comprising a sequence selected from the group consisting of sequences complementary to a mRNA sequence of a mammalian ribonucleotide reductase protein component R1 or sequence segment thereof or sequences complementary to a mRNA sequence of a mammalian ribonucleotide reductase protein component R2 or sequence segment thereof.
Another aspect is a method of inhibiting metastasis of tumor cells in a mammal which method comprises administering to said mammal an amount sufficient to inhibit tumor cell growth of an antisense oligonucleotide from at least about three nucleotides or nucleotide analogues to about fifty nucleotides in length comprising a sequence selected from the group consisting of sequences complementary to a mRNA sequence of a mammalian ribonucleotide reductase protein component R1 or sequence segment thereof or sequences complementary to a mRNA sequence of a mammalian ribonucleotide reductase protein component R2 or sequence segment thereof.
Another aspect is an isolated DNA with a sequence comprising a transcriptional initiation region and a sequence encoding an antisense oligonucleotide from at least about three nucleotides or nucleotide analogues to about fifty nucleotides in length comprising a sequence selected from the group consisting of sequences complementary to a mRNA sequence of a mammalian ribonucleotide reductase protein component R1 or sequence segment thereof or sequences complementary to a mRNA sequence of a mammalian ribonucleotide reductase protein component R2 or sequence segment thereof.
FIGS. 1A-C are photographs of gels (A and B) and two scans (C) showing the analysis of Myc-eptiope tagged R2 expression from stable infectants by Western blot analysis using monoclonal anti-Myc epitope antibody 9E10 (A), polyclonal rabbit anti-R2 serum (B), and during the cell cycle by flow cytometry, using antibody 9E10 (C).
FIGS. 2A-C are photographs (A and B) and a graph (C) of experiments measuring transformed foci wherein (A) shows infection of BALB/c 3T3 (a) and NIH 3T3 (b) cells with SH/mR2 did not lead to focus formation. (B) There was an increase in focus formation with B3/mR2 (b) and N3/mR2 (d) compared to B3/SH (a) and N3/SH (c) after transfection with the T24 H-ras plasmid. (C) The number of foci formed in three independent ras transfection experiments was plotted.
FIGS. 3A-C are photographs of soft agar growth (A) and graphs (B and C) wherein (A) shows expression of Myc-R2 in ras-transformed cells resulted in an increased growth efficiency in soft agar. Examples shown are r-3/mR2 and uninfected r-3 cells (See Table 4). (B) C1/mR2 cells showed reduced tumor latency and increased growth rate when compared to C1/SH control cells where 3×10 5 cells from logarithmically growing cultures were collected and subcutaneously injected into five syngeneic C3H/HeN mice/cell line/experiment. Results presented are from two independent experiments. The p value of t test analysis of tumor growth rates is shown, and indicates that the growth rates for the two cell lines are significantly different. (C) C1/mR2 cells exhibited elevated metastatic potential.
FIGS. 4A-C are graphs wherein (A) shows an increased amount of Raf-1 protein associated with the membrane in R2 overexpressing cells. The recombinant R2 expressing cell lines B3/mR2, N3/mR2, C1/mR2, r-2/mR2, r-3/mR2 and NR4/mR2 (R2) were compared to their respective control lines, B3/SH, N3/SH, C1/SH, r-2/SH, r-3, and NR4 (control). In all cases, cells expressing recombinant R2 exhibited increased membrane associated Raf-1 protein, and when the two groups of cell lines were compared, they were found to be significantly different by t test analysis (p<0.001). (B) Also shows an increase in the activity of mitogen activating protein kinase (MAPK-2) in R2 overexpressing cells. The recombinant R2 expressing lines B3/mR2, N3/mR2, 10T/mR2, C1/mR2, r-2/mR2 and NR4/mR2 (R2) were compared to their respective control lines infected with LXSH (controls). In all cases tested, cells expressing recombinant R2 showed increased enzyme activity, and the difference between two groups was highly significant (p<0.001). (C) Shows increased foci formation with N3/mR2 cells compared to N3/SH cells after transfection with the activated V12 Rac-1 plasmid. The number of foci shown represents the average±SE from two independent experiments.
FIGS. 5A-B are photographs of gels showing examples of Southern blot analysis of CAD (A) and DHFR (B) DNA with mouse L cells. FIG. 5A: H-4 cells not exposed to drug as a control (a), H-4 cells from a colony that developed in the presence of 50 μM PALA (b), or in the presence of 60 μM PALA (c). DNA was digested to completion with XbaI. FIG. 5B: SC2 cells not exposed to drug as a control (a), SC2 cells from colonies that developed in the presence of 80 nM methotrexate (MTx) (b) and (c). DNA was digested to completion with PstI.
FIGS. 6A-B are photographs of gels showing examples of Southern blot analysis of CAD (A) and DHFR (B) DNA with BALB/c 3T3 cells. DNA was digested to completion with PstI. FIG. 6A: B3/mR2 cells not exposed to PALA (a), and B3/mR2 cells from colonies that developed in the presence of 40 μM PALA (b), or in the presence of 50 μM PALA (c). FIG. 6B: B3/mR2 cells not exposed to MTX (a), and B3/mR2 cells from colonies that developed in the presence of 60 nM MTX (b),or in the presence of 80 nM MTX (c).
FIG. 7 is a photograph of a Western blot analysis of R2 protein levels in N/R2-4 (a) and N/R2+ASR2 (b) cells. To distinguish the vector R2 protein from the endogenous gene product in transfected cells, a human c-myc epitope coding for ten amino acids plus methionine was placed at the 5′ end of the cDNA for R2. Recombinant (upper band) and endogenous (lower band) R2 protein is observed in lane a and is markedly reduced in R2 antisense containing cells (lane b). Both cell lines grew with approximately the same doubling time of about 16 hours.
FIG. 8 is a photograph of a gel showing p53-DNA binding activity in cells from colonies that developed in the presence of PALA, MTX or hydroxyurea. (a) control 1B cells that are p53-null, (b) B3/mR2 cells that grew in the presence of 20 μM PALA, (c) B3/R2c2 cells that grew in the presence of 40 μM PALA, (d) B3/mR2 cells that grew in the presence of 40 nM MTX, (e) B3/R2c2 cells that grew in the presence of 60 nM MTX, (f) B3/mR2 cells that grew in the presence of 0.20 mM hydroxyurea, and (g) B3/R2c2 cells that grew in the presence of 0.30 mM hydroxyurea. Cells were incubated with 32 P-labeled p53 consensus binding sequence in the presence of antibody 421, which activates p53 for DNA binding. Note the presence of complexes in all cell lines except in the 1B control p53-null cells. Low molecular weight complex formation results from p53-DNA binding and high molecular weight complex formation results from antibody supershifted p53-DNA binding.
FIG. 9 is a graph showing the number of transformation foci in (a) NIH-3T3 mouse cells containing the H-ras oncogene, (b) NIH-3T3 mouse cells containing the H-ras oncogene and the R2 antisense sequence and (c) NIH-3T3 mouse cells containing the H-ras oncogene and the coding region sequence for R2. Results are averages of three experiments.
FIGS. 10A-B are photographs of a Western blot analysis of AS-II-626-20 inhibition (A) and inhibition by a variety of R2 antisense oligonucleotides (B) of ribonucleotide reductase R2 protein level in L60 mouse tumor cells. FIG. 10A mouse tumor cells (a); mouse cells with AS-II-626-20 (b); mouse cells with scrambled AS-II-626-20 (c); mouse cells with mismatched AS-II-626-20 (d). FIG. 10B mouse tumor cells (a); treated with AS-II-667-20 (b); AS-II-816-20 (c); AS-II-1288-20 (d); AS-II-1335-20 (e); AS-II-1338-20 (f).
FIG. 11 is a graph showing the percentage inhibition by various antisense oligonucleotides in the colony formation of MDA-MB-231 human breast cancer cells.
FIG. 12 is a graph showing the inhibition of colony formation by AS-I-618-20. The cell lines are HepG2 (liver), SK-OV-3 (ovary), U87 (brain), A2058 (melanoma), H460 (lung), MDA-MB-231 (breast) and AsPC-19pancreas).
FIG. 13 is a photograph of a Western blot of R1 protein expression after treatment of MDA-MB-231 human breast cancer cells with various antisense oligonucleotides.
FIG. 14A is a photograph of the Western Blot of R1 protein expression after treatment with AS-I-618-20. control=untreated cells, scrambled—cells treated with a scrambled version of AS-I-618-20 (same proportion of GTAC but an entirely different sequence) and mismatched—a mutated version of AS-I-618-20 with a 4 base mismatch. FIG. 14B is a graph of the R1 protein levels in the Western Blot quantitated using Image Quant program (Molecular Dynamics) and expressed in arbitrary units (Relative intensity).
FIG. 15 is a photograph of immunoprecipitation gel. SRC—scrambled version of AS-I-618-20; MIS—mismatched version of AS-I-618-20
FIG. 16 is an autoradiograph of a Northern Blot of mRNA from various cells either untreated or treated with AS-I-618-20. HT-29 is a human colon adenocarcinoma cell line and MDA-MB-231 is a human breast adenocarcinoma cell line.
FIG. 17 is a graph showing the weight of human lung cancinoma (H460) tumors in mice after treatment with various antisense oligonucleotides.
FIG. 18 is a graph showing the weight of the various tumors in mice after treatment with AS-I-618-20. Light color bars are results obtained from untreated controls, and the darker color bars are results from animals treated with AS-I-618-20.
FIG. 19 is a graph showing the rate of growth of the human lung carcinoma tumors in nude mice with or without treatment with 1 mg/kg AS-I-618-20.
FIG. 20 is an autoradiograph of a Northern blot of ribonucleotide reductase R1 mRNA in HT-29 human colon tumors in mice after treatment with AS-I-618-20.
FIG. 21 is a graph showing the weight of human colon carcinoma (HT-29) tumors in CD-1 nude mice after treatment with various antisense oligonucleotides.
FIG. 22 is a graph showing the weight of human melanoma (A2058) tumors in CD-1 nude mice after treatment with various antisense oligonucleotides.
FIG. 23 is a graph showing the weight of human lung carcinoma tumors in CD-1 nude mice after treatment with various antisense oligonucleotides.
Definitions:
As used herein, the following terms have the following meanings:
The term “antisense oligonucleotide” as used herein means a nucleotide sequence that is complementary to the desired mRNA. Preferably, the antisense oligonucleotide is complementary to the ribonucleotide reductase mRNA. It is contemplated that the antisense oligonucleotide may be complementary to any of the 5′ untranslated region of the mRNA, the coding region or the 3′ untranslated region of the mRNA.
The term “oligonucleotide” refers to an oligomer or polymer of nucleotide or nucleoside monomers consisting of naturally occurring bases, sugars, and inter-sugar (backbone) linkages. The term also includes modified or substituted oligomers comprising non-naturally occurring monomers or portions thereof, which function similarly. Such modified or substituted oligomers may be preferred over naturally occurring forms because of the properties such as enhanced cellular uptake, or increased stability in the presence of nucleases. The term also includes chimeric oligonucleotides which contain two or more chemically distinct regions. For example, chimeric oligonucleotides may contain at least one region of modified nucleotides that confer beneficial properties (e.g. increased nuclease resistance, increased uptake into cells) or two or more oligonucleotides of the invention may be joined to form a chimeric oligonucleotide.
The antisense oligonucleotides of the present invention may be ribonucleic or deoxyribonucleic acids and may contain naturally occurring or synthetic monomeric bases, including adenine, guanine, cytosine, thymine and uracil. The oligonucleotides may also contain modified bases such as xanthine, hypoxanthine, 2-aminoadenine, 6-methyl, 2-propyl and other alkyl adenines, 5-halo uracil, 5-halo cytosine, 6-aza uracil, 6-aza cytosine and 6-aza thymine, pseudo uracil, 4-thiouracil, 8-halo adenine, 8-aminoadenine, 8-thiol adenine, 8-thiolalkyl adenines, 8-hydroxyl adenine and other 8-substituted adenines, 8-halo guanines, 8-amino guanine, 8-thiol guanine, 8-thioalkyl guanines, 8-hydroxyl guanine and other 8-substituted guanines, other aza and deaza uracils, thymidines, cytosines or guanines, 5-trifluoromethyl uracil and 5-trifluoro cytosine. The modifications may also include attachment of other chemical groups, such as methyl, ethyl, or propyl groups, to the various parts of the oligonucleotides including the sugar, base or backbone components.
The antisense oligonucleotides of the invention may also comprise modified phosphorus oxygen heteroatoms in the phosphate backbone, short chain alkyl or cycloalkyl intersugar linkages or short chain heteroatom or heterocyclic intersugar linkages. For example, the antisense oligonucleotides may contain methyl phosphonates, phosphorothioates, phosphorodithioates, phosphotriesters, and morpholino oligomers. In one embodiment of the invention, the antisense oligonucleotides comprise phosphorothioate bonds linking between the four to six 3′-terminus nucleotides. In another embodiment, the phosphorothioate bonds link all the nucleotides. The antisense oligonucleotides may also have sugar mimetics.
The antisense oligonucleotides of the invention may also comprise nucleotide analogues wherein the structure of the nucleotide is fundamentally altered. An example of such an oligonucleotide analogue is a peptide nucleic acid (PNA) wherein the deoxyribose (or ribose) phosphate backbone in DNA (or RNA) is replaced with a polyamide backbone which is similar to that found in peptides (Nielsen et al. 1991; Good and Nielsen, 1998; Buchardt, deceased, et al., U.S. Pat. No. 5,766,855; Buchardt, deceased, et al., U.S. Pat. No. 5,719,262). PNA analogues have been shown to be resistant to degradation by enzymes and to have extended lives in vivo and in vitro. PNAs also bind more strongly to a complementary DNA sequence than to a naturally occurring nucleic acid molecule due to the lack of charge repulsion between the PNA strand and the DNA strand.
The oligonucleotides of the present invention may also include other nucleotides comprising polymer backbones, cyclic backbones, or acyclic backbones. For example, the nucleotides may comprise morpholino backbone structures (U.S. Pat. No. 5,034,506).
The oligonucleotides of the present invention are “nuclease resistant” when they have either been modified such that they are not susceptible to degradation by DNA and RNA nucleases or alternatively they have been placed in a delivery vehicle which in itself protects the oligonucleotide from DNA or RNA nucleases. Nuclease resistant oligonucleotides include, for example, methyl phosphonates, phosphorothioates, phosphorodithioates, phosphotriesters, and morpholino oligomers. Suitable delivery vehicles for conferring nuclease resistance include, for example liposomes.
The oligonucleotides of the present invention may also contain groups, such as groups for improving the pharmacokinetic properties of an oligonucleotides, or groups for improving the pharmacodynamic properties of an oligonucleotide.
The antisense oligonucleotides are preferably selected from the sequence complementary to the ribonucleotide reductase mRNA or gene sequences such that the sequence exhibits the least likelihood of showing duplex formation, hair-pin formation, and homooligomer/sequence repeats but has a high to moderate potential to bind to the ribonucleotide reductase mRNA or gene sequences. These properties may be determined using the computer modeling program OLIGO Primer Analysis Software, Version 3.4 or 5.0 (distributed by National Biosciences, Inc., Plymouth, Minn.). This computer program allows the determination of a qualitative estimation of these five parameters.
Alternatively, the antisense oligonucleotides may also be selected on the basis that the sequence is highly conserved for either the ribonucleotide reductase gene between two or more mammalian species. These properties may be determined using the BLASTN program (Altschul, et al.) of the University of Wisconsin Computer group (GCG) software (Devereux J. et al. 1994) with the National Center for Biotechnology Information (NCBI) databases.
The antisense oligonucleotides may include mutations, such as substitutions, insertions and deletions. Preferably there will be less than 10% of the sequence having mutations.
The antisense oligonucleotides generally comprise from at least about 3 nucleotides or nucleotide analogs, more preferably they are at least about 5 nucleotides, more preferably they are at least about 7 nucleotides, more preferably they are at least about 9 nucleotides and most preferably they are at least about 12 nucleotides. The antisense oligonucleotides are preferably less than about 100 nucleotides or nucleotide analogs, more preferably, less than about 50 nucleotides or nucleotide analogs, most preferably less than about 35 nucleotide or nucleotide analogs.
Preferably, the antisense oligonucleotides comprise the sequences set forth in Tables 1, 2 and 3 (below).
| TABLE 1 | ||||
| ANTISENSE SEQUENCES DESIGNED TO TARGET THE R2 MESSAGE | ||||
| Tm | dG | |||
| SEQ ID No: | Name | Sequence 5′-3′ | (° C.) | Kcal/mol |
| SEQ ID No:3 | AS-II-6-20 | ACCCTTCCCATTGGCTGCGC | 62.8 | −45.5 |
| SEQ ID No:4 | AS-II-13-20 | GsCCsTCCGsACCsCTTCsCCsATTsG | 60.1 | −43.7 |
| SEQ ID No:5 | AS-II-14-20 | TGCCTCCGACCCTTCCCATT | 60.1 | −43.7 |
| SEQ ID No:6 | AS-II-16-18 | TGCCTCCGACCCTTCCCA | 58.4 | −40.3 |
| SEQ ID No:7 | AS-II-75-20 | CsGCGsCGCsTCCsCGGsCCCsTTCsC | 72.7 | 53.7 |
| SEQ ID No:8 | AS-II-75-20 | CGCGCGCTCCCGGCCCTTCC | 72.7 | −53.7 |
| SEQ ID No:9 | AS-II-79-14 | CGCGCTCCCGGCCC | 59.1 | −38.8 |
| SEQ ID No:10 | AS-II-109-20 | CsCCCsTCACsTCCsAGCsAGCsCTsT | 57.9 | −41.8 |
| SEQ ID No:11 | AS-II-110-20 | ACCCCTCACTCCAGCAGCCT | 57.3 | −41.2 |
| SEQ ID No:12 | AS-II-114-20 | GGCGACCCCTCACTCCAGCA | 61.8 | −43.2 |
| SEQ ID No:13 | AS-II-127-12 | GCACGGGCGACC | 41.7 | −28.8 |
| SEQ ID No:14 | AS-II-130-20 | TGGGACAGGGTGCACGGGCG | 67.6 | −46.7 |
| SEQ ID No:15 | AS-II-134-20 | GACGGCTGGGACAGGGTGCA | 62.6 | −43.2 |
| SEQ ID No:16 | AS-II-151-20 | GAGCAGCCAGGACAGGACGG | 59.3 | −41.7 |
| SEQ ID No:17 | AS-II-163-20 | GsCGsAAGsCAGsAGCsGAGsCAGCsC | 62.1 | −44.3 |
| SEQ ID No:18 | AS-II-166-20 | GCAGCGAAGCAGAGCGAGCA | 61.4 | −43.1 |
| SEQ ID No:19 | AS-II-185-20 | GGGAGAGCATAGTGGAGGCG | 56.0 | −40.9 |
| SEQ ID No:20 | AS-II-189-20 | CGGAGGGAGAGCATAGTGGA | 54.1 | −39.4 |
| SEQ ID No.21 | AS-II-201-20 | GCGAGCGGGACACGGAGGGA | 63.5 | −45.1 |
| SEQ ID No:22 | AS-II-217-20 | CGGGTCCGTGATGGGCGCGA | 69.5 | −48.8 |
| SEQ ID No:23 | AS-II-225-20 | AGCTGCTGCGGGTCCGTGAT | 61.4 | −43.6 |
| SEQ ID No:24 | AS-II-253-14 | CCCCTTCAGCGGCG | 50.8 | −34.4 |
| SEQ ID No:25 | AS-II-280-20 | CGGCGGCGTGTTCTCCTTGT | 61.8 | −44.2 |
| SEQ ID No:26 | AS-II-288-12 | CGGCGGCGTGTT | 43.2 | −29.6 |
| SEQ ID No:27 | AS-II-323-20 | TCCTCGCGGTCTTGCTGGCC | 64.1 | −45.5 |
| SEQ ID No:28 | AS-II-344-20 | CCGTGGGCTCCTGGAAGATC | 58.0 | −41.9 |
| SEQ ID No:29 | AS-II-362-20 | CTGCTTTAGTTTTCGGCTCC | 51.2 | −39.2 |
| SEQ ID No:30 | AS-II-391-17 | CGGCTCATCCTCCACGC | 54.5 | −37.3 |
| SEQ ID No:31 | AS-II-404-20 | GGTTTTCTCTCAGCAGCGGC | 56.4 | −41.4 |
| SEQ ID No:32 | AS-II-412-20 | GCGGCGGGGGTTTTCTCTCA | 62.8 | −45.8 |
| SEQ ID No:33 | AS-II-414-20 | AAGCGGCGGGGGTTTTCTCT | 60.7 | −45.8 |
| SEQ ID No:34 | AS-II-425-20 | GGAAGATGACAAAGCGGCGG | 59.1 | −43.0 |
| SEQ ID No:35 | AS-II-439-20 | ATGGTACTCGATGGGGAAGA | 50.8 | −37.8 |
| SEQ ID No:36 | AS-II-472-20 | AGCCTCTGCCTTCTTATACA | 46.1 | −35.8 |
| SEQ ID No:37 | AS-II-494-20 | CCTCCTCGGCGGTCCAAAAG | 60.4 | −44.3 |
| SEQ ID No:38 | AS-II-496-16 | TCCTCGGCGGTCCAAA | 54.8 | −37.0 |
| SEQ ID No:39 | AS-II-549-20 | TATCTCTCCTCGGGTTTCAG | 48.4 | −36.7 |
| SEQ ID No:40 | AS-II-579-20 | GCAAAGAAAGCCAGAACATG | 50.0 | −37.2 |
| SEQ ID No:41 | AS-II-619-20 | TCGCTCCACCAAGTTTTCAT | 52.1 | −38.3 |
| SEQ ID No:42 | AS-II-626-20 | GGCTAAATCGCTCCACCAAG | 53.9 | −40.3 |
| SEQ ID No:43 | AS-II-634-20 | AACTTCTTGGCTAAATCGCT | 48.0 | −37.6 |
| SEQ ID No:44 | AS-II-667-20 | GAAGCCATAGAAACAGCGGG | 53.9 | −40.3 |
| SEQ ID No:45 | AS-II-784-20 | GACACAAGGCATCGTTTCAA | 50.9 | −36.8 |
| SEQ ID No:46 | AS-II-798-20 | TCTGCCTTCTTCTTGACACA | 48.0 | −34.9 |
| SEQ ID No:47 | AS-II-816-20 | ATCCAGCGCAAGGCCCAGTC | 60.9 | −43.7 |
| SEQ ID No:48 | AS-II-861-20 | GCAAAGGCTACAACACGTTC | 50.0 | −37.1 |
| SEQ ID No:49 | AS-II-890-20 | AACCGGAAAAGAAAATGCCT | 52.2 | −40.4 |
| SEQ ID No:50 | AS-II-909-20 | CAGAATATCGACGCAAAAGA | 48.2 | −36.5 |
| SEQ ID No:51 | AS-II-933-20 | GGCATCAGTCCTCGTTTCTT | 50.8 | −37.7 |
| SEQ ID No:52 | AS-II-981-20 | TGTAAACCCTCATCTCTGCT | 46.2 | −35.0 |
| SEQ ID No:53 | AS-II-1001-20 | TCAGGCAAGCAAAATCACAG | 51.3 | −37.2 |
| SEQ ID No:54 | AS-II-1006-20 | GAACATCAGGCAAGCAAAAT | 49.4 | −37.1 |
| SEQ ID No:55 | AS-II-1023-20 | TTGTGTACCAGGTGTTTGAA | 45.9 | −33.9 |
| SEQ ID No:56 | AS-II-1040-20 | CTCTCTCCTCCGATGGTTTG | 51.1 | −37.7 |
| SEQ ID No:57 | AS-II-1048-20 | TTCTCTTACTCTCTCCTCCG | 45.2 | −35.0 |
| SEQ ID No:58 | AS-II-1144-20 | GTATTGCTTCATTAGAGTGC | 41.6 | −33.0 |
| SEQ ID No:59 | AS-II-1182-20 | CCCAGTTCCAGCATAAGTCT | 48.4 | −36.5 |
| SEQ ID No:60 | AS-II-1197-20 | AAAACCTTGCTAAAACCCAG | 48.3 | −37.8 |
| SEQ ID No:61 | AS-II-1217-20 | CAAATGGGTTCTCTACTCTG | 43.7 | −33.8 |
| SEQ ID No:62 | AS-II-1224-20 | ATAAAGTCAAATGGGTTCTC | 42.6 | −34.0 |
| SEQ ID No:63 | AS-II-1254-20 | TTAGTCTTTCCTTCCAGTGA | 43.8 | −33.9 |
| SEQ ID No:64 | AS-II-1278-20 | TCGCCTACTCTCTTCTCAAA | 46.8 | −35.6 |
| SEQ ID No:65 | AS-II-1288-20 | CCTCTGATACTCGCCTACTC | 45.6 | −35.1 |
| SEQ ID No:66 | AS-II-1302-20 | GACATCACTCCCATCCTCTG | 48.7 | −35.3 |
| SEQ ID No:67 | AS-II-1335-20 | GCATCCAAGGTAAAAGAATT | 45.6 | −36.1 |
| SEQ ID No:68 | AS-II-1338-20 | TCAGCATCCAAGGTAAAAGA | 47.4 | −35.9 |
| SEQ ID No:69 | AS-II-1342-20 | GAAGTCAGCATCCAAGGTAA | 46.7 | −35.3 |
| SEQ ID No:70 | AS-II-1345-20 | TTAGAAGTCAGCATCCAAGG | 47.0 | −35.6 |
| SEQ ID No:71 | AS-II-1362-20 | GCACATCTTCAGTTCATTTA | 42.4 | −32.8 |
| SEQ ID No:72 | AS-II-1364-20 | GGGCACATCTTCAGTTCATT | 48.9 | −36.2 |
| SEQ ID No:73 | AS-II-1381-20 | AAAAATCAGCCAAGTAAGGG | 48.1 | −38.0 |
| SEQ ID No:74 | AS-II-1390-20 | ATGGAAAAAAAAAATCAGCC | 48.1 | −38.0 |
| SEQ ID No:75 | AS-II-1438-20 | TTCATGGTGTGGCTAGTTGG | 50.8 | −36.8 |
| SEQ ID No:76 | AS-II-1499-20 | AGGACTGGTTGTGAGGTAGC | 48.1 | −35.7 |
| SEQ ID No:77 | AS-II-1517-20 | CCAGCACTATAAACAGACAG | 42.2 | −32.8 |
| SEQ ID No:78 | AS-II-1538-20 | TTCTGGCAAAAGGTGATACT | 46.5 | −35.6 |
| SEQ ID No:79 | AS-II-1560-20 | GTAAGTCACAGCCAGCCAGG | 52.2 | −37.8 |
| SEQ ID No:80 | AS-II-1581-20 | ACTGCCATTGTCACTGCTAT | 47.0 | −34.9 |
| SEQ ID No:81 | AS-II-1659-20 | TGGCTGTGCTGGTTAAAGGA | 53.2 | −38.7 |
| SEQ ID No:82 | AS-II-1666-20 | TTTTAACTGGCTGTGCTGGT | 50.0 | −37.2 |
| SEQ ID No:83 | AS-II-1700-20 | ATTAAAATCTGCGTTGAAGC | 46.8 | −36.6 |
| SEQ ID No:84 | AS-II-1768-20 | TATCGCCGCCGTGAGTACAA | 56.5 | −40.9 |
| SEQ ID No:85 | AS-II-1773-20 | GCTATTATCGCCGCCGTGAG | 57.1 | −42.6 |
| SEQ ID No:86 | AS-II-1775-12 | ATCGCCGCCGTG | 42.9 | −29.5 |
| SEQ ID No:87 | AS-II-1790-20 | GAAACCAAATAAATCAAGCT | 43.4 | −34.9 |
| SEQ ID No:88 | AS-II-1819-20 | TTAGTGGTCAGGAGAATGTA | 41.7 | −32.5 |
| SEQ ID No:89 | AS-II-1976-20 | TGGCACCAACTGACTAATAT | 44.5 | −34.2 |
| SEQ ID No:90 | AS-II-1989-20 | CCTGTCTTCTATCTGGCACC | 48.6 | −36.2 |
| SEQ ID No:91 | AS-II-2009-20 | GCCACAGGATAAAAACACAA | 47.7 | −35.9 |
| SEQ ID No:92 | AS-II-2026-20 | CCCAGGACACTACACAAGCC | 51.8 | −37.5 |
| SEQ ID No:93 | AS-II-2044-20 | TCAGAGGGGGCAGAGAATCC | 55.4 | −40.2 |
| SEQ ID No:94 | AS-II-2067-20 | TCCTTTATCCCACAACACTC | 46.3 | −35.0 |
| SEQ ID No:95 | AS-II-2083-20 | CCTTGCCCTGAGAGATTCCT | 52.3 | −39.0 |
| SEQ ID No:96 | AS-II-2083-20 | CsCTsTGsCCsCTsGAsGAsGAsTTsCCsT | 52.3 | −39.0 |
| SEQ ID No:97 | AS-II-2128-20 | GGCCCAGATCACCCCTAAAT | 54.3 | −40.9 |
| SEQ ID No:98 | AS-II-2151-20 | AAACGGCTTCTCACACATAT | 46.3 | −35.4 |
| SEQ ID No:99 | AS-II-2164-20 | GAGAAATAAAATGAAACGGC | 46.2 | −36.6 |
| SEQ ID No:100 | AS-II-2182-20 | CGTTGAGGAAAATACAGTGA | 45.1 | −34.3 |
| SEQ ID No:101 | AS-II-2229A- | GCTCCCACATATGAAAACTC | 46.1 | −35.2 |
| 20 | ||||
| SEQ ID No:102 | AS-II-2372-20 | CACACAACCTACTTACACCA | 42.7 | −32.3 |
| Footnotes for Table 1 | ||||
| Name includes the following: | ||||
| AS = antisense; | ||||
| II = R2 | ||||
| The first number indicates the first nucleotide position in the R2 mRNA sequence. | ||||
| The second number indicates the length of the sequence segment. | ||||
| The sequence AS-II-2229A shown in the Table and the sequence AS-II-2229B described in the text are alternate sequences, with 2229A chosen from the version of R2 in GENIBANK (submitted by Pavloff) and 2229B chosen from the version published by Pavloff et al. 1992. | ||||
| Sequences were fully thioated unless partial thioation is indicated (s) | ||||
| TM° C. = melting temperature of oligonucleotide duplex formed. | ||||
| dG = free energy values of oligonucleotide-complement dimer formation | ||||
| In addition to the above analysis, estimates of potential dimer formation (D) potential self-complementary interactions (H) and the potential to bind to sequences in the R2 message other than the target sequences (B) were obtained. Analysis and estimates described above were obtained by using the computer modelling program OLIGO Primer Analysis Software, Version 3.4 (distributed by National Biosciences). | ||||
| The program allows the determination of Tm° C. and dG values, and also provides a qualitative estimation of The D, H and B parameters indicating “no potential”, “some potential, or essentially “complete potential”. | ||||
| In choosing the oligonucleotide sequences we gave high priority to sequences that exhibited high Tm° C. and dG values, which are important for tight binding of antisense molecules to their complementary strands, and high priority to antisense sequences that had estimates of no potential in D, H and B. Of the three categories (D, H, B) the most important ones were D and H, since B (i.e., binding to other regions of the R2 mRNA in addition to the precise target sequence) may enhance rather than compromise oligonucleotide activity. | ||||
| Most of the sequences shown in Table 1 had no potential in the D and H categories, some sequences exhibited “some potential” in D or H and were later found in tumor cell growth inhibition studies to be effective (Table 13) and therefore were also included in Table 1. We found that this approach to choosing antisense oligonucleotide inhibitors was extremely effective, since the vast majority of the chosen seque | ||||