Match Document Document Title
6943027 Preparation of stable formulations of lipid-nucleic acid complexes for efficient in vivo delivery  
The present invention provides for lipid:nucleic acid complexes that have increased shelf life and high transfection activity in vivo following intravenous injection, and methods of preparing such...
6939862 Method for transferring nucleic acid into striated muscles  
The invention provides a method of transferring in vivo a molecule into a striated muscle cell. More specifically, a method of the invention comprises contacting in vivo a striated muscle cell with...
6939860 Composition and method for treatment of neoplastic diseases associated with elevated matrix metalloproteinase activities using catechin compounds  
The present invention relates to a composition comprising a catechin compound, ascorbic acid, proline and lysine. The present invention also relates to a method for treating neoplastic disease...
6939540 Method of enhancing bone density  
The present invention is directed to a method for enhancing bone density or formation. In accordance with the method, a nucleic acid encoding an angiogenic protein is administered to a cell in a...
6936595 Tumour-specific vector for gene therapy  
The invention relates to a vector for the gene therapeutic treatment of tumours, especially in connection with radiotherapy. Said vector is provided with a therapeutic gene in the DNA sequence...
6936594 Gene therapy for cerebrovascular disorders  
By introducing hepatocyte growth factor (HGF) gene and/or vascular endothelial growth factor (VEGF) gene into the subarachnoid space in humans, cerebrovascular disorders such as cerebrovascular...
6936593 Method of down-regulating gene expression  
Disclosed is a method of down-regulating the expression of a gene in an animal, wherein a pharmacological formulation comprising a chimeric oligonucleotide complementary to the gene is orally...
6936464 Immune responses to fusion proteins  
The invention relates to a nucleic acid construct for delivery into living cells in vivo for inducing an immune response in a patient to an idiotypic determinant present on a malignant B cell in...
6936243 Adeno-associated viral vector-mediated delivery of DNA to cells of the liver  
The instant invention provides methods of expressing polynucleotides in the cells of the liver comprising administering viral particles comprising a recombinant AAV vector into a mammal, preferably...
6934639 Methods for designing agents that interact with MMP-13  
The present invention relates to the three dimensional structure of human collagenase 3 (MMP-13), as well as to (i) methods of using the MMP-13 structure to rationally design or identify compounds...
6933286 Therapeutic delivery compositions and methods of use thereof  
The present invention relates to compositions and methods for treating infectious diseases and genetic disorders through gene therapy and intracellular delivery of antisense oligonucleotides or...
6933284 Methods and tools for identifying compounds which modulate atherosclerosis by impacting LDL-proteoglycan binding  
The present invention relates to the study and control of atherosclerosis through the modulation of LDL-proteoglycan binding at Site B (amino acids 3359-3369) of the apo-B100 protein in LDL. The...
6933133 Treatment of diabetes with synthetic beta cells  
Disclosed is a method for obtaining glucose-regulated expression of active insulin in the cells of a mammalian subject. The method involves delivering into the subject a genetic construct...
6930095 Hepatitis C virus constructs characterized by high efficiency replication  
The present invention relates to recombinant hepatitis C virus (HCV)-derived nucleic acids and to stable rapidly growing cell clones derived from human hepatoma Huh-7 cell line and supporting high...
6930094 Tissue factor for influencing blood vessel formation  
The present invention relates to the use of tissue factor for influencing blood vessel formation, particularly for activating blood vessel formation, above all for wound healing.
6929913 Compositions and methods for regulating autolytic processes in bacteria  
A nucleic acid sequence required for regulating the autolytic activity of bacteria is provided. Also provided are polypeptides encoded by the gene or mutant gene as well as vector and host cells...
6929792 Modified dendritic cells and use therefor  
The invention provides isolated dendritic cells genetically modified to express a selectin polypeptide, optionally treated with activated platelets or membrane microparticles thereof. The invention...
6923958 DNA vaccines encoding CEA and a CD40 ligand and methods of use thereof  
A DNA vaccine effective for eliciting an immune response against cells that present a carcinoembryonic antigen (CEA) comprises a DNA operably encoding a CEA and a DNA operably encoding a CD40...
6921542 Preparation of a therapeutic composition  
Product R, a novel therapeutic composition for treating viral infections and stimulating the immune system, comprises a unique peptide having 31 amino acids and another unique peptide having 21...
6921534 Hepatitis B virus treatment  
The invention relates to HBV antigen-containing compositions that are useful in treating or preventing HBV infection. The content of the compositions can vary, as described herein, but the...
6919319 Immuno-modulating effects of chemokines in DNA vaccination  
The present invention relates to a composition and method for enhancing the efficacy of a vaccine in a subject treated with the vaccine by administering to the subject an antigen in conjunction...
6919318 Enhancing immune responses to genetic immunization by using a chemokine  
The immune response to a DNA immunogen in a mammal can be enhanced by administration of a chemokine or a polynucleotide encoding the chemokine. This method can be used, for example, to immunize or...
6919207 Method for regulating genes with electromagnetic response elements  
A non-invasive method for gene regulation during gene therapy comprises the steps of introducing electromagnetic field response elements into a gene promoter not having any electromagnetic field...
6919203 Peptides for inducing cytotoxic T lymphocyte responses to hepatitis B virus  
Peptides are used to define epitopes that stimulate HLA-restricted cytotoxic T lymphocyte activity against hepatitis B virus antigens. The peptides are derived from regions of HBV envelope, and are...
6919187 Compounds and methods for treatment and diagnosis of chlamydial infection  
Compounds and methods for the diagnosis and treatment of Chlamydial infection are disclosed. The compounds provided include polypeptides that contain at least one antigenic portion of a Chlamydia ...
6919083 Nucleic acid and amino acid sequences of infectious salmon anaemia virus and their uses as vaccines  
The present invention provides the use of nucleic acid sequences and/or amino acid sequences in the preparation of a vaccine for the protection of fish against infectious salmon anaemia virus....
6916793 Selenium-containing pro-drugs for cancer therapy  
Methods for inhibiting the growth of tumor cells by combination treatment with a selenium-containing prodrug and an enzyme for which it is a substrate are described. The treatment also enhances the...
6916654 Universal donor cells  
Genetically engineered cells are provided which can serve as universal donor cells in such applications as reconstruction of vascular linings or the administration of therapeutic agents. The cells...
6916470 Methods for use of mpl ligands with primitive human stem cells  
Myeloproliferative leukemia receptor (mpl) ligands, such as thrombopoietin, act on a primitive subpopulation of human stem cells having the characteristics of self-renewal and ability to give rise...
6914054 Methods and compositions for treating hepatitis C virus  
A method and composition for treating a host infected with hepatitis C comprising administering an effective hepatitis C treatment amount of a described 1′, 2′ or 3′-modified nucleoside or a...
6911424 2′-fluoronucleosides  
A class of 2′-fluoro-nucleoside compounds are disclosed which are useful in the treatment of hepatitis B infection, hepatitis C infection, HIV and abnormal cellular proliferation, including...
6908618 Production of novel bovine respiratory syncytial viruses from cDNAs  
A method of producing an attenuated bovine respiratory syncytial virus (BRSV) having increased or decreased transcription and/or replication, as compared to a wild-type BRSV, including the steps of...
6906041 Treatment of immune diseases  
The invention concerns the use of a nucleic acid capable of expressing beta-interferon for the preparation of a pharmaceutical composition for the treatment of an immune disease.
6906026 Methods for treating conditions associated with the accumulation of excess extracellular matrix  
The present invention is methods and compositions for reducing and preventing the excess accumulation of extracellular matrix in a tissue and/or organ or at a wound site using a combination of...
6905678 Gene delivery vectors with cell type specificity for mesenchymal stem cells  
Methods and associated materials for transducing mesenchymal stem cells with a desired nucleic acid. Mesenchymal stem cells are a recently discovered kind of stem cell for which suitable transfer...
6903078 Combination PDGF, KGF, IGF, and IGFBP for wound healing  
The invention provides a therapeutic composition for epithelial wound repair that is a combination of PDGF and KGF. Further, the invention provides a composition for epithelial wound repair that is...
6903077 Methods and products for delivering nucleic acids  
The invention relates to products and methods for delivering nucleic acids of various sizes and preferably greater than 50 kilobases into cells. The nucleic acids are delivered as part of a nucleic...
6902731 Methods of treating hyperproliferative disorders using retinoblastoma fusion proteins  
Fusions of the transcription factor E2F and the retinoblastoma protein RB are provided, along with methods of treatment of hyperproliferative diseases.
6900187 TRPM-2 antisense therapy using an oligonucleotide having 2′-O-(2-methoxy)ethyl modifications  
A compound consisting of an oligonucleotide of sequence CAGCAGCAGAGTCTTCATCAT, where the oligonucleotide has a phosphorothioate backbone throughout, the sugar moieties of nucleotides 1-4 and 18-21...
6900186 Method for the prophylaxis and/or treatment of medical disorders  
The present invention relates generally to a method for the prophylaxis and/or treatment of skin disorders, and in particular proliferative and/or inflamatory skin disorders, and to genetic...
6900185 Method of inducing tumor cell apoptosis using trail/Apo-2 ligand gene transfer  
The present invention is directed to methods for inhibiting tumor cell growth, causing tumor regression or eliminating tumor cells in a mammal afflicted with a tumor by administering to a...
6900010 Compositions and methods for detecting human immunodeficiency virus  
Methods are provided for screening natural and synthetic anti-HIV agents using recombinant cells that are rendered susceptible to productive infection of various strains, subtypes or clades of HIV...
6899731 Controlled delivery of therapeutic agents by insertable medical devices  
A medical device and method for transportation and release of a therapeutic agent into a mammalian body are disclosed. The medical device is coated with alternating layers of a negatively charged...
6897200 Oligonucleotide delivery systems for camptothecins  
Camptothecin drugs are stabilized in their antitumor active lactone form by complexation with an oligonucleotide including RNA or catalytic RNA. The oligonucleotide-camptothecin drug complex may be...
6897196 pH sensitive lipids based on ortho ester linkers, composition and method  
The invention comprises lipid derivatives that rapidly degrade in the pH range from 4.0 to 7.0 and lipidic delivery systems that contain them. These lipid derivatives can be used to modify the...
6897068 Polynucleotide complex delivery  
Disclosed is a complex for providing nucleic acid expression in a cell. A polynucleotide and a polymer are mixed together to form the complex wherein the zeta potential of the complex is not...
6897057 Cell-specific and/or tumor-specific promoter retargeting of herpes γ 34.5 gene expression  
The present invention relates to herpes viral mutants and methods of using these viral mutants for selectively targeting tumor cells or other populations of target cells. The viral mutants of the...
6897016 Alteration of sequence of a target molecule  
Method for splicing a target nucleic acid molecule with a separate nucleic acid molecule. Such splicing generally causes production of a chimeric protein with advantageous features over that...
6894031 Pituitary tumor transforming gene (PTTG) carboxy-terminal peptides and methods of use thereof to inhibit neoplastic cellular proliferation and/or transformation  
Disclosed is a method of inhibiting neoplastic cellular proliferation and/or transformation of mammalian cells, including cells of human origin, in vitro or in vivo. The inventive method involves...
6893634 Encapsulated cells producing cytochrome P450  
The present invention relates to capsules encapsulating cytochrome P450 producing cells and cytochrome P450 producing retroviral packaging cells. Furthermore, the present invention relates to the...